Life is so Beautiful is a non-profit site to promote the desire for a self-less world, a place where trust can be placed on anyone. The author aims to beautify the world in terms of mind.
Friday, December 16, 2011
Cute Girl - Price Tag Cover by 3 year old Gabrielle
Cute little girl singing!
Comments:
ahh naa noo PRRRRRRRIIICCCCCCCEEEEEEEE TTTTTTTAAAAAAGGGGGGGG!!!!!!!!!!!!!!! cute
daniisawsomeful 27 seconds ago
how cute ! :)
dairyqueen1998 8 minutes ago
she's so cute !! i love her
dinaki123zouzounaki 11 minutes ago
crazy
biilgin 12 minutes ago
de banii jtie sa zik :)))))
DaNyDaNy560 12 minutes ago
awwwwww
shannonluvsumiley 13 minutes ago
EVRYBODY LOOK TO THE LEFT!!!! EVRYBODY LOOK TO THE RIGHT!!!!!!!!!!! ;) xx shes so adorable xoxoxoxoxox
vicplum123 16 minutes ago
how can u dislike this ?
ZigecTheFreak 21 minutes ago in playlist Liked
I never EAT AT NIGHT :D
A-d-o-r-a-b-l-e :)
MileyCyrusTheBest101 23 minutes ago
ahhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
dollyadeoye 29 minutes ago
It's sounds like she says:
Look over there, some fries
i'm gonna eat at night
Lalala lalala
Stop the noodles at nine
Soooooo sweet!!!
TamanaVevo 29 minutes ago
it is full of sweet
hacobamer 32 minutes ago
money money money hahahahahhaha $
TheSweatestBitch 32 minutes ago
Ssssooooooo ccccuuuuuuuttttteeee
SuperBadoori 43 minutes ago
hehe laughed a lot :DD
tymex123s 44 minutes ago
Damn, I think Justin Bieber has goten himself a compatitor xD
UntitledScars 44 minutes ago
this is the cutes thing ever! >< <3
PlonkerStar 49 minutes ago
she's so cute <3
nata05091990 58 minutes ago
megaa , ona jest rozwalająca .
Megaa megaa ;**
karoliinqqa 1 hour ago
Comment removed
karoliinqqa 1 hour ago
Oh My God she's adorable and she's got groove...U rock BabyGirl :0)
MaikaDee 1 hour ago
how cute *-*
rachelheldenhaft 1 hour ago
OMG she´s soooooo sweeet!!o.o
SweetGirl6Love 1 hour ago
sweet!
RaicoEbel 2 hours ago
aahhh love :')
ApplesAndDaisies 2 hours ago
qe gracinhaaaaaaaaaaaa
jimkasuya1 2 hours ago
wow great :D
JoyceMaryLy 2 hours ago
ahh soooo cute
charzz1999 2 hours ago
pritty good
crazyfrog1oo 2 hours ago
AAAAAAAAAAAAAAACH
Veertjee00 2 hours ago
sooooooooooooooooo cutee
awesomemess1 2 hours ago
better than justin bieber ;)
MusikTv95 2 hours ago 15
@MusikTv95 hahaha
budakcomelish 2 hours ago
@MusikTv95 Way more
MultiJC90 49 minutes ago
hahaha !! very cuteeee :D <3
BsrMhr 2 hours ago
money, money, money. *Stops for a while* Money, money, money. HAHAHAHAHAHA, So cuteee~
JoycelynHiga3001 2 hours ago
that cute! greater cuteness I have ever seen! own ..
lknmee 2 hours ago
She wants that Dad, GET IT. 0:22. lol
ch3ckth1s0ut1 3 hours ago
thats soo cute.love it.<3 how could anybody dislike?:O
themillyfication 3 hours ago
aww cute
kaari0 3 hours ago
Awwww thats adorable well done
L96A1iiMontagez 3 hours ago
More daddy moorree XD<333333 cuuuutttee
AnneBanne99 3 hours ago
laaalaalaalaalaaala HEEEEEY Lalalallaaaaa HEEEEEEY, so cute.
melissaa13xkus 3 hours ago 15
@melissaa13xkus Hha XD
AnneBanne99 3 hours ago
What it sounds like: Look over there they got some fries Go and eat at night doodeedoodeedoo just stop the noodles and cry Everybody looks to the LEFT everybody looks to the RIGHT feel that yah were paying with luck tonight ............... money, money, money ............... money,money,money wow dance pwice tag
sgnorush 3 hours ago
wow very nice
Gerula94 3 hours ago
sooooo cuutee lookss like my little sis
ellePHAM 3 hours ago
@101Sparkeygirl
Jealous in what????a guy that looks like a girl and sings like somebody is trying to strangle him xD
marjoh1024 3 hours ago
all i heard was: there is no better , a want to sleep at night.........
ellePHAM 3 hours ago
i don't like.. :D
ThEnDiary 3 hours ago
For a three year old, that is amazing! I love how she knows left and right!
RashmikaClavain 3 hours ago
vilken låt är det?
TheRyttse97 3 hours ago
sweeeeet.*-*
MsZuckermaedchen 3 hours ago
Cute but you can only hear some words:P she is soo adorable so i liked
sssslc 4 hours ago
ang cute hahaha !!
ericacute01 4 hours ago
ahh so adorable!
suzanxx1 4 hours ago
how sweet she is ;D
JessiSch0k0keks 4 hours ago
better than Jus... nah, why would I say that? Everybody know this...
RHAFerreira46 4 hours ago
Wow 3yr old knows her left and Rights.
D2A2n2y 4 hours ago
WHAT A LITTLE RETARTED ANNOYING DEVILISH FUCKING GIRL.
bdahits11045 4 hours ago
adorable! she makes me smile :)
sarahlovesbeauty7 4 hours ago
i loveeee it ' she so much cuteeee !!!
~israel the Queen !
ישראל שלייטה (:
shanyny3 5 hours ago
i love how she says bling a bling
avianministry123 5 hours ago
1:47 - " More daddy, more" ?
GucciDivah 5 hours ago
she needs to learn the words.
blueberryjupiter 5 hours ago
She is soooooooo cute =DD <3
Just9Monika 5 hours ago
Lol how sweet she is so cute hahahaha
bumblebeegirl2000 5 hours ago
Shes just so cute xx
Brianlicker2012 5 hours ago
Amazing!♥
She is soo sweet, will you be mine Baby?:D
VIPJojoMaus 5 hours ago
she's so cute!!!!!!!!!!!!!!
missesthercool 5 hours ago
ADORABLE LMAO
Ellybananas 5 hours ago
shes so cute
saramaishasings 5 hours ago
sweeeeeeeeeeeeeeeeeet :D :D
MrMartin989898 5 hours ago
:O oh dear the only things she said right is money money, cha ching - ching and bling bling
Renzky 5 hours ago
awwwsweet howcute and shes ADORABLE!!!
FfionS1 6 hours ago
I disliked it because it hurts my fucking ears.
mrsmoothcruiser 6 hours ago
soooooo cute she's adorable ;p
all people dislike that are crazy it's just cute <3
GaelleBreezy 6 hours ago
soooo sweet (:
winxgirl2000 6 hours ago
süßßßßßß ;*
dascoolekind 6 hours ago
so cute!!!!
fB2530yTuZeR23 6 hours ago
ow!!!!!!!!nice one.....
1loverukia07 7 hours ago
She is so cute and the reason she cant sing is BECAUSE SHE IS 3!!!!!
1212ILUVME 7 hours ago
so cute...love it much......!even though i can't understand,stl shes cute....
1loverukia07 7 hours ago
LOL
undeadlive007 7 hours ago
so cute*__*
96Canii 7 hours ago
YOU SUCKKK BOOOOOOO TROLOLOLOLOOL >:D
mixtraack 8 hours ago
This has been flagged as spam show
MrFrozenThrown 8 hours ago
supper cute
SuperSamira28 8 hours ago
tena para PRICE i nena nina NIGHT! NI NA NA NE NA TA every body look to the left! every body look to the light XD... I DONT UNDERSTAND..
CDOC39 8 hours ago 16
@CDOC39 ha ah aha ah ah aha haaaha ha ah yeah she is saying that
KemjFlores28 8 hours ago
How can anyone not love this, I have watched it many times and think its the cutest thing that I have ever seen! Just adorable!
NiceGirl47100 9 hours ago
awww! bet she's gonna be a good singer when she's older.
Jellybeanifyer 9 hours ago
CUUUTE
gembelobosok 9 hours ago
What an adorable kid. :)
analynnjois 10 hours ago
aaaahh Super cuteee(lll)
TheMassey35 10 hours ago
dsdsadsgdsgdadahdydeyddyedyedfgdgdhgdsjfgbdjgbfdsgbfd
gbkdsjgdkjfgdjgdfsgsbdghdfskgjdsfgbdfsgbdfsggkdsgfhdsgbfd
sjgbfdjgbdskjgbdjg MONEY,MONEY,MONEY,MONEY,MONEY
YEH.DFSDFSDFDFVGFVDFVDFDFGDFDFDFDFBDKLFDGKGDKGBDG
YEH.FDFDJBFGDJBGJDGJGJDFGBDGDJGFDGK
OHHH.. SO CUTE :D
karenayson 10 hours ago
1,749 people are canadians.
Sean0fWar 10 hours ago 2
so cute♥♥
hewvip 10 hours ago
1,749 people are jealous
MsCherry1999 11 hours ago
woah
MsCherry1999 11 hours ago
i m just wanna say shit to all the people who dislike it
moekhantminlwin 11 hours ago
1,748 are zombies!
naniniish 11 hours ago
price tag or priceless ?
nabilfaizi 11 hours ago
she knows what rhythm is!
cacagion 12 hours ago
เก่งมาก
jom07276 12 hours ago
lol
princessjada007 12 hours ago
awww sooo adorable
f4m0uzashes 12 hours ago
OMGGG...soooooooo CUTEE
MegRocks0 12 hours ago
This is soo adorable!! Awww
Nikki9dr 12 hours ago
This has been flagged as spam show
minkao3 12 hours ago
Why would you dislike that? She is adorable! (:
fooksyisagun98 13 hours ago 35
Beautiful Things:
cute girl,
cute video,
gabrielle,
life is beautiful
Saturday, December 3, 2011
Wednesday, November 23, 2011
Beautiful Teacup Female Maltese
Comments:
<3 i cant another word....? it so much i will die!?
daysi0319 1 month ago 3
so cute!!!!!!!!!!!!!!?
urilcamm 4 months ago
awwwwwwwwwwwwwww she's so cute <3 ?
justinbieberizhot100 4 months ago 2
wheree can you buy this kindd of dogg for? a cheapp pricee??/:)
gracekim1000 4 months ago 4
i know if i brung tht pup to show? n tell they'd be like wats that ball of fur doin here lolz
mzallstar1234567 5 months ago 3
GAAAAAHHHHH SOOO CUTE IMMA? GO CRAZY IF I DON'T GET ONE!!!!!!
TT_TT
abbykinnz 5 months ago 5
ahhhhhh omg i wished it was my puppy:((?
love23kl 6 months ago
is she? for sale
purplelili1 6 months ago
what a cutieeeeeee ^_^ how much did it cost?!? i want to buyyy? one theyre veryy cute
xhoke96 7 months ago
AWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWHHHHHHHHHHHHHHHHHHHHHHHHHHHHHEEEEEEEEEEEEE!!!!!! :3 <3 <3 <3? <3
DubstepKittyKoda 7 months ago
Soooo cute!!?
alluringinnocence 7 months ago
i would? like to have the same please!!! i adore it!!!!can i have info???
bellydancervivi 7 months ago
Shee is adorablle!! I literally squealed(sp?) at herr cuuteness!!! i justt wanna takke her hoome!! <33 So cuute hoow she keeps bakking away froom the edge [= Most videos i have seeen of them actualy rolling aaround jumping off, but awwz! This onee iss adorable x.x imma? stopp watchinng pup vids or else imma be upp all nighht lol [=
AnIiMeKitty 7 months ago
ohhhmyyygoshhhh she? is precious <3
littlemissrissy 8 months ago
this has to be the cutest dog i ever seen!!!!!! omg its so cuteeeee!!! its hypnotizing by it's cuteness!!! gosh i want it!!?
katiifavz3 8 months ago
I'm gonna get one and name her Pixie.
P.S. that names been in my mind since I was? 7
Treyskywalker77 9 months ago
My Bella looks JUST like? this. <3
cutepurpleprincess 9 months ago
hey? does anyone know where they sell heese in london at all i really want one !
loisgeorge123 10 months ago 38
im steeling it lol ?
MusicIsMyWorld347 11 months ago 127
ADORABLE! i really want a tea-cup dog but there? sooo expensive !
beachbabie020 11 months ago
FUCKING D'AWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW?
hitlermustache 1 year ago
i would like to? buy her!!!
if you are selling her how much is she?
x3dontknowxoxo 1 year ago
AWWW, She's so adorable! Is she for sale? ?
cindyxella 1 year ago
awwwwwwww!!!!!!!! <3 i? want! :)
peacexlovexmaddiex 1 year ago
Beautiful Things:
beautiful dog,
beautiful maltese,
beautiful video,
cute dog,
cute maltese,
cute video,
life is beautiful
Tuesday, November 15, 2011
Smile because life is beautiful - 3
Beautiful Things:
beautiful picture,
beautiful smile,
cute picture,
life is beautiful
Tuesday, November 1, 2011
Project RunThruSingapore
By owner:
Uniquely and entirely shot on Steadicam, RunThruSingapore expresses our love for Singapore.
Simulating the run through Singapore in a day, we want to show an epic journey of a young man exploring the beauty of Singapore by running across the entire nation, passing through places that are new, old and even unexplored by Singaporeans.
Comments from public:
awesome & fantastic video featuring the lives & spirits of Singapore...shared with my overseas friends and they loved it... just a small suggestion: use those past NDP theme songs as the background music/song. ..that would be a perfect gift for 46th NDP or anyone who watch it in the future...excellent work, guys...:)
san90520 1 week ago 3
wah lau, watched this vid 20 times already and i'm still not tired of it...
bastronut 1 week ago 2
Mute this video and pause it at 0:13, play the local band Electrico's song Faces: youtube.com/watch?v=OOcCeRQQFFE as the background soundtrack for this video. sit back and enjoy. makes this video a true carthasis and a reflection of being singaporean.
frogboychickenrice 2 weeks ago 4
Comment removed
frogboychickenrice 2 weeks ago
thumbs up if you recognize all of the places he ran to :)
waterpolorox 2 weeks ago 4
I feel that this is one of the best Singapore-made clips that I've ever seen thus far, surpassing the standards of Mediacorp and their NDP videos!!
tianhua1993 3 weeks ago 4
I'm an overseas Singaporean. This video makes me more well-disposed towards 'home' than any number of national day videos.
zonkaroonie 3 weeks ago 7
awesome shoot! so nice to see familiar places but in a different perspective..
ilovefourlettersword 4 weeks ago
@SteadiProductions How did you film it so steadily if you were running with him?
XreflectX 1 month ago
This has been flagged as spam show
tianhua1993 3 weeks ago
wooooooo hot boy:D cblock <3
anyonehere13 1 month ago
Hey all! There will be a meet and greet session on the 4th SEPT for everyone to find out more about Telok Blangah CC YEC, Project RunThruSingapore & SteadiProductions.
We will be launching the "Making's of Project RunThruSingapore too"
Additionally, there will be a live demonstration on how to operate a SteadiCam.
SteadiProductions 1 month ago
ah, this is kinda nostalgic
setsunaftw 1 month ago
Awesome job! Thank you so much. I want to share with my friend. Pround of you all..thumb up
melodyjouful 1 month ago 2
How did you all get the steady shot while running??
Drummer8nimation 1 month ago
Sengkang at 5:03
Drummer8nimation 1 month ago
It made me fall in love with Singapore again. Brought a tear to my eye this quiet morning in Tokyo...can't wait to go home. Thanks for making it. It's fantastic.
terminalcase42 1 month ago 3
@terminalcase42 Glad you liked it... I'm sure you'll get home soon!
thevideographer90 1 month ago
oh my god. i wanted to do a video like this too in stop motion. someone beat me to it! D: great vid!
titanlyy 1 month ago
Well done ! Steady lah.... ! :D
beyon13 1 month ago
I like how s'pore is the only country that you can run around in less then 8 mins..Awesome!!!
sooriyah007 1 month ago
Good concept and good effort! :)
Lxmby 1 month ago
awesome video man !
TraceurJY 1 month ago
Beautiful.
alloaw 1 month ago
Awesome job ! Just curious, how many days did you take to shoot ? :)
Hafiz93 1 month ago
@Hafiz93 It took us about 6 months to complete the shoot!
SteadiProductions 1 month ago
This video should be renamed as .. Around Singapore in 7:36 mins
ChiliKeY 1 month ago 2
Nice video, would be perfect if he can run in LKY's and the ministers' houses.
graysg 1 month ago
i super like! fantastic idea!
eminozy 1 month ago
luckily he did not run on PIE.........
helltoturingforever 1 month ago
Hats of you! Great job!
babusaj1 1 month ago
Good job guys!
ahkl77 1 month ago
great video, get a great tour of Singapore this way.
gopher3737 1 month ago
what's the triangular building in the background at 1:24? it's one of my favourite buildings in Singapore but I still haven't figured out its name!
puddleofgooify 1 month ago
@puddleofgooify It's the Golden Mile Complex building ;)
SteadiProductions 1 month ago
loved itt!
eldridtan 1 month ago
Nice Video. Some of these places I even didn't even explored, haha. Good Job!
SAD2656594 1 month ago 2
this video is awesome! the entire idea and concept is absolutely refreshing and beautiful. A million round of applause to the production team
iONGGY 1 month ago
this is beautiful :) well done!
jngsh 1 month ago
Ying Quan, just ignore them. You're a running demi-god! ...second only to the camera man who presumably was running backwards! This is fantastic! Six months well invested in my book. Thank you all so very much!
johnnymcsporran 1 month ago
Thoroughly enjoyed this video, especially the part on Kranji War Memorial. I went there when I was a soldier and that felt especially meaningful. Would love to go back there to pay respect again.
thelastrebirth 1 month ago
What a brilliant concept & video! Kudos to Jason and Ying Quan for directing & producing such an original and moving vid!! A truly Made-In-Singapore project that I can proudly show off to foreign friends!
(Hwvr, i do wish that you had inserted a part where the jogger buys some flowers from the market or something, so that there's a context to how the flowers suddenly appeared in his hands when he placed them at the war memorial. Also, is there a reason why yr 24-hr jogger wasnt credited?:)
jellycomics 1 month ago 8
@jellycomics Thanks for your praise! =) Well! The Runner is Ying Quan! He is the producer and runner =)
SteadiProductions 1 month ago 3
i wish you guys could add captions for all the locations (i know it's a lot of work) - ashamed to say i can't identify all of them. but fantaaaastic video. thanks for renewing my love for singapore!
zephyr84 1 month ago
@zephyr84 Hello Zephyr! I detailed breakdown of the location can be found in the google map placed under our video!
SteadiProductions 1 month ago
Great concept. Good and admirable effort. However, only one criticism from me is - the crossfade editing is badly executed. It would better serve with good and fast straight cut.
Overall, proud of the video!
Keep up the good work.
davade2 1 month ago
how did u film him running? were u on the back of a bike or something?
Zetality 1 month ago
@Zetality Hi Zetality, we flipped the LCD monitor of the 60D to the side and ran together with the runner!
SteadiProductions 1 month ago
@SteadiProductions then how come so stable while you film and run?
rykalbapakkau 1 month ago
@rykalbapakkau Read the comment. It says shot using Steadicam.
ZonMng 1 month ago
@rykalbapakkau Read the info. It says shot using Steadicam.
ZonMng 1 month ago
Thanks for your support guys! Do support our passion for Singapore by sharing our video with fellow Singaporeans and also your International Friends!
Do follow us on our youtube channel & like our Facebook page
SteadiProductions 1 month ago
i see my neighborhood! <3 the vid. thanks.
bajero 1 month ago
The video was very well flimed. It shows a lot of planning and effort putting in.
Unfortunately the guy in the video don't looks like a runner. He got no running style. Should get a real runner that glide like those Kenyas' long distance runners and with proper running attire. Then this video will be a very captivating one. Showcasting our beautiful island.
cityhousefly 1 month ago
pruss wan for awesomeness
weedee88 1 month ago
Thanks so much for producing this clip. Even when I'm out of Singapore, it feels home watching this.
eclipsingly 1 month ago 2
great job..makes me feel like running too!
auzistar 1 month ago 2
A wonderful production gues... well done! I love it!
avongxay 1 month ago
awesome stuff they should have shown this at NDP 2011.
neon0mega 1 month ago
Awesome video! Shows that there are still some places left that I've yet to explore in Singapore. :)
AshrafSpore 1 month ago
Lovely video :)
I do agree. There really is a lot of beauty all around, a lot going on on this little island. The ironic thing is that I didn't grow up in "that Singapore" - I never went to Kampong Glam or Little India as a kid. I discovered these places as an adult, and I like them because they are evocative of bits of local history that're exotic to me.
lkaiping 1 month ago
Amaaaaazing. Looking forward to RTS2 - The places we missed during RTS1.
astrodotsg 1 month ago
This is the best video that STB never produced. Also a very lovely paean to Singaporeans.
piggnant 1 month ago
this is awesome! it was fun guessing which part of SG he was running thru! Im based in KL now, and even tho Im in a neighbouring country, i dont get to go home often enough. Now this has put a huge smile on my face on this lovely Sunday morning. Good job guys. a simple concept but well executed. :)
fidahrashid 1 month ago
Locations are all jumbled up and the guy didnt perspire at all makes it a little weird. BUT nonetheless awesome effort made <3
faithloh1 1 month ago
Pandan reservoir! 2.4km run for rv students :)
athena149 1 month ago
might have worked better if the guy didn't run like a girl.
saetria 1 month ago
Very very nice! The guy looks like he would have done a pretty good marathon time. How did his hair stay so perfectly coiffed during the run? ;) BTW what official run did he run through when he was at the Padang?
enp01sg 1 month ago 2
Comment removed
sirspiff 1 month ago
Wow!
fujie94 1 month ago
this is da bomb:DD
niebuhrnobfear 1 month ago
who in the right mind will dislike this vid?!
tans0249 1 month ago
RUN FOREST RUN!!
therepublicist 1 month ago
The credits section wrote "Unmarked Guitars" -- I think that's a mistake.
muhammadhirman 1 month ago
So many nice places that I don't recognize! Good job with the video.
Arktos08 1 month ago 2
Awesome!
muhammadhirman 1 month ago
Take how long to complet the run :)
georgeporky 1 month ago
@georgeporky It took us 6 months to film this =D
SteadiProductions 1 month ago
wa lao eh, I wanna do that, but I can't run further than 100metres
IAmNotFatdotNet 1 month ago
yet another production from ruicheng and team. i like it :D
ibeee 1 month ago
omg i saw the park beside jp and boonlay shopping centre! LOL.... nice one!
marshtuber 1 month ago
any one can tell me wad that 2 song name ?
iphone4999 1 month ago
@iphone4999 It is in the video description, just click on the 'Show more' tab..
odomisauq 1 month ago
did he run to the zoo? where did you find this guy, NO SWEAT!!! HAHA but this is an awesome vid. the editing was great, the music was great, lighting. BRILLIANT!!!
i wish i'd thought of this.
stjap19 1 month ago
@stjap19 Yo! Nope we did not run the Zoo! Thanks for Supporting us =)
SteadiProductions 1 month ago
@SteadiProductions will look forward to your up and coming video.
stjap19 1 month ago
okay who wants to plan a running route based on this video?
jkai27 1 month ago
Overall it's awesome, the songs go very well with the video as well. kudos to your efforts. I have a humble suggestion, maybe next time can feature local music ? Especially those local indie artistes like 53a and Inch Chua. Trying working with them if possible, it would be mutually beneficial for the creative industry here in sg. =)
odomisauq 1 month ago 2
@odomisauq Hi odomisauq, yes it would be great to work with local indie artistes! It was our original choice to use local music in the first place, but lack of time to source and work out details meant using The Jezabels, who are really good :) If I had a choice, definitely local! Thanks for the band suggestions!
SteadiProductions 1 month ago
By the way, I'd be sharing it with my family and other friends as well ;)
ff9garnet90 1 month ago
@ff9garnet90 Hi ff9garnet90, thank you for the support!
SteadiProductions 1 month ago
Wonderful video =).Give me a tight feeling to my chest and make me feel that, once again, I'm proud to be a Singaporean. Great job guys =)!
ff9garnet90 1 month ago
This is beautifully done. :D
Does anyone know what the building at 05:19 is?
geeksomeguy 1 month ago
@geeksomeguy 5.19 is Orchard Ion =)
SteadiProductions 1 month ago 2
Lovely video. But wai u no support local music :(
plovery0 1 month ago 2
@plovery0 We will definitely do that in our next video :)
SteadiProductions 1 month ago
IS HE FOREST GUMP?? he looks like he runs funny.
jilun 1 month ago
2 people are foreign talent.
kenilim 1 month ago 35
awesome video. gives a warm fuzzy feeling inside especially for those overseas who are missing home. =)
linkingd0ts 1 month ago
Great concept! But found the guy bowing at both the Kranji War Cemetery and Civilian War Memorial a bit strange (esp for the civilian war memorial- considering it's a commemoration of those who perished during ww2) Overall, nice video!
plxn 1 month ago 2
Comment removed
plxn 1 month ago
Comment removed
plxn 1 month ago
Well done. Makes me feel all warm and patriotic inside
johnsmith1330 1 month ago 2
Yes!
DotaLord1993 1 month ago
this is lovely, Happy Birthday Singapore :))
ghostbabe38 1 month ago
Great video! If we put all our political affiliations and typical Singaporean cynicism aside, we can take a step back and actually notice that we have a rather beautiful country. Makes me miss home a wee bit. Happy birthday, Singapore! Lots of love from Pittsburgh! <3
Eghhhh 1 month ago 2
Darn got to rewatch it for the scenic shots I missed. Spent too much time looking at his chest
yardypoop 1 month ago 22
@yardypoop cuz his chest says zoom?
zhiyang434 1 month ago
This is a nice and creative video, but a little too long. Nevertheless well done
vinvgohg 1 month ago
very well done guys!
wubefrub 1 month ago
This is one of the most beautiful and touching videos I have ever watched as a Singaporean.
1337hacks 1 month ago 2
@1337hacks Thanks for your support! HAPPY NATIONAL DAY!!
SteadiProductions 1 month ago
Nice work Jason! Glad that I met you last Sunday :) (60D Battery grip eh?) See you again soon!
aochengsu 1 month ago
Great job on the video. With all that is happening in Singapore now, somehow your video has made me proud to be a Singaporean again. Thank you. Happy National Day
daniel7521 1 month ago 2
@daniel7521 Happy national day to you too! Thanks a lot for your support! Let us all be proud of our beautiful country and show it to the world!
SteadiProductions 1 month ago
heeeeeeee
doggie1993 1 month ago
also @5.43 would have been awesome if they jumped on that passenger bike and filmed it, would be nice to add a little comedy in it :)
thesoftmint 1 month ago
i like how he doesnt sweat at all
endot 1 month ago 5
@endot its the shirt XD really =D
SteadiProductions 1 month ago
Wonderful video! Thank you so much for your time and effort making it, I really appreciate it!
Living overseas, I never realised how much I missed Singapore until how emo I got when watching this. I really teared up after all the different scenes that I've personally walked and been in.
Fantastic job :-)
rinaz 1 month ago
@rinaz Thanks!!! Do check out the google map for the locations so that when you come back to visit Singapore again! You'll see them =)
Do share it with your overseas and show them the Beauty of our Country!!
SteadiProductions 1 month ago
Happy National Day to All! Do lend us your support for our simple project by sharing it with all your loved ones and international friends too!
SteadiProductions 1 month ago
Wow, on the faster scenes, the steadi-cameraman must really have quite a strong arm D:
wksim91 1 month ago
@wksim91 Our director Jason need a lot of arm training just for this HAHA
SteadiProductions 1 month ago
This is a really wonderful video. (Personally I would have used Martin Solveig's 'Ready To Go' song for the music but that's just me). I thought I knew most of Singapore but you have shown me a lots of sites I have yet to visit! THank you! Also, having the map of his run is very helpful. Can't wait to use this info in my next visit this December!
TorontoViewer 1 month ago
@TorontoViewer Thanks for your kind words! Do lend us your support and help us to spread our video around!
SteadiProductions 1 month ago
Man I was hoping he would run on the water from Ubin back to Changi Ferry Terminal. Disappointed.
chelidagreat 1 month ago 2
I was thinking he could have swam back to sg.
a1beng 1 month ago
Awesome vid! But why go from jurong to woodlands then back down to gombak then to ang mo kio. Lol.. It's not consistent. But the other places are all linked and consistent.
xiangyao1 1 month ago
@xiangyao1 Haha! We tried to somewhat ran a complete round but its quite difficult to link in the end
SteadiProductions 1 month ago
what about Pulau Tekong mate!
Overall an awesome job guys =)
tohwushu 1 month ago
@tohwushu LOL that place can't be filmed sadly
SteadiProductions 1 month ago
Danny MacAskill - "Way Back Home" go check it out. the video uses the same song and its also about this man cycling around somewhere. (as opposed to a guy running)
ngzhongqin 1 month ago
@ngzhongqin Yea! we got inspiration from that video too =)
SteadiProductions 1 month ago
Comment removed
ngzhongqin 1 month ago
is he wearing a bra?
thesoftmint 1 month ago 2
@thesoftmint No the actor is not wearing a bra =.=
SteadiProductions 1 month ago
@SteadiProductions haha i just kidding, nice video anyway, althought u should get a shot of tekong, quite a intresting site tbh, i am sure that if u asked u might have been able to do it.
thesoftmint 1 month ago
@thesoftmint lol now that's all i can see!
omgsianz 1 month ago
@omgsianz Thanks! Help us spread the msg =)
SteadiProductions 1 month ago
Great job Mr Tan! Now I know why you are all that busy during our SAGE rehearsals. :D
Thanks for your support and guidance albeit your busy schedule!!
andrew651992 1 month ago
@andrew651992 Help us spread the love in JJC too!
SteadiProductions 1 month ago
how many months it took to make this video? :O
mingz 1 month ago
@mingz It took us 8 Months in total, 6 Months to carry out the filming =)
SteadiProductions 1 month ago
That dude didn't run through Singapore
firdaus125 1 month ago
@firdaus125 Well we didn't literally ran through Singapore on foot, but we indeed travel through almost every single part of Singapore!
SteadiProductions 1 month ago
Great work. why not geylang...
mock83 1 month ago 4
Hey There! Thanks for your support! We did film geylang but the scene didn't turn out nice unfortunetely
SteadiProductions 1 month ago
Comments from public:
awesome & fantastic video featuring the lives & spirits of Singapore...shared with my overseas friends and they loved it... just a small suggestion: use those past NDP theme songs as the background music/song. ..that would be a perfect gift for 46th NDP or anyone who watch it in the future...excellent work, guys...:)
san90520 1 week ago 3
wah lau, watched this vid 20 times already and i'm still not tired of it...
bastronut 1 week ago 2
Mute this video and pause it at 0:13, play the local band Electrico's song Faces: youtube.com/watch?v=OOcCeRQQFFE as the background soundtrack for this video. sit back and enjoy. makes this video a true carthasis and a reflection of being singaporean.
frogboychickenrice 2 weeks ago 4
Comment removed
frogboychickenrice 2 weeks ago
thumbs up if you recognize all of the places he ran to :)
waterpolorox 2 weeks ago 4
I feel that this is one of the best Singapore-made clips that I've ever seen thus far, surpassing the standards of Mediacorp and their NDP videos!!
tianhua1993 3 weeks ago 4
I'm an overseas Singaporean. This video makes me more well-disposed towards 'home' than any number of national day videos.
zonkaroonie 3 weeks ago 7
awesome shoot! so nice to see familiar places but in a different perspective..
ilovefourlettersword 4 weeks ago
@SteadiProductions How did you film it so steadily if you were running with him?
XreflectX 1 month ago
This has been flagged as spam show
tianhua1993 3 weeks ago
wooooooo hot boy:D cblock <3
anyonehere13 1 month ago
Hey all! There will be a meet and greet session on the 4th SEPT for everyone to find out more about Telok Blangah CC YEC, Project RunThruSingapore & SteadiProductions.
We will be launching the "Making's of Project RunThruSingapore too"
Additionally, there will be a live demonstration on how to operate a SteadiCam.
SteadiProductions 1 month ago
ah, this is kinda nostalgic
setsunaftw 1 month ago
Awesome job! Thank you so much. I want to share with my friend. Pround of you all..thumb up
melodyjouful 1 month ago 2
How did you all get the steady shot while running??
Drummer8nimation 1 month ago
Sengkang at 5:03
Drummer8nimation 1 month ago
It made me fall in love with Singapore again. Brought a tear to my eye this quiet morning in Tokyo...can't wait to go home. Thanks for making it. It's fantastic.
terminalcase42 1 month ago 3
@terminalcase42 Glad you liked it... I'm sure you'll get home soon!
thevideographer90 1 month ago
oh my god. i wanted to do a video like this too in stop motion. someone beat me to it! D: great vid!
titanlyy 1 month ago
Well done ! Steady lah.... ! :D
beyon13 1 month ago
I like how s'pore is the only country that you can run around in less then 8 mins..Awesome!!!
sooriyah007 1 month ago
Good concept and good effort! :)
Lxmby 1 month ago
awesome video man !
TraceurJY 1 month ago
Beautiful.
alloaw 1 month ago
Awesome job ! Just curious, how many days did you take to shoot ? :)
Hafiz93 1 month ago
@Hafiz93 It took us about 6 months to complete the shoot!
SteadiProductions 1 month ago
This video should be renamed as .. Around Singapore in 7:36 mins
ChiliKeY 1 month ago 2
Nice video, would be perfect if he can run in LKY's and the ministers' houses.
graysg 1 month ago
i super like! fantastic idea!
eminozy 1 month ago
luckily he did not run on PIE.........
helltoturingforever 1 month ago
Hats of you! Great job!
babusaj1 1 month ago
Good job guys!
ahkl77 1 month ago
great video, get a great tour of Singapore this way.
gopher3737 1 month ago
what's the triangular building in the background at 1:24? it's one of my favourite buildings in Singapore but I still haven't figured out its name!
puddleofgooify 1 month ago
@puddleofgooify It's the Golden Mile Complex building ;)
SteadiProductions 1 month ago
loved itt!
eldridtan 1 month ago
Nice Video. Some of these places I even didn't even explored, haha. Good Job!
SAD2656594 1 month ago 2
this video is awesome! the entire idea and concept is absolutely refreshing and beautiful. A million round of applause to the production team
iONGGY 1 month ago
this is beautiful :) well done!
jngsh 1 month ago
Ying Quan, just ignore them. You're a running demi-god! ...second only to the camera man who presumably was running backwards! This is fantastic! Six months well invested in my book. Thank you all so very much!
johnnymcsporran 1 month ago
Thoroughly enjoyed this video, especially the part on Kranji War Memorial. I went there when I was a soldier and that felt especially meaningful. Would love to go back there to pay respect again.
thelastrebirth 1 month ago
What a brilliant concept & video! Kudos to Jason and Ying Quan for directing & producing such an original and moving vid!! A truly Made-In-Singapore project that I can proudly show off to foreign friends!
(Hwvr, i do wish that you had inserted a part where the jogger buys some flowers from the market or something, so that there's a context to how the flowers suddenly appeared in his hands when he placed them at the war memorial. Also, is there a reason why yr 24-hr jogger wasnt credited?:)
jellycomics 1 month ago 8
@jellycomics Thanks for your praise! =) Well! The Runner is Ying Quan! He is the producer and runner =)
SteadiProductions 1 month ago 3
i wish you guys could add captions for all the locations (i know it's a lot of work) - ashamed to say i can't identify all of them. but fantaaaastic video. thanks for renewing my love for singapore!
zephyr84 1 month ago
@zephyr84 Hello Zephyr! I detailed breakdown of the location can be found in the google map placed under our video!
SteadiProductions 1 month ago
Great concept. Good and admirable effort. However, only one criticism from me is - the crossfade editing is badly executed. It would better serve with good and fast straight cut.
Overall, proud of the video!
Keep up the good work.
davade2 1 month ago
how did u film him running? were u on the back of a bike or something?
Zetality 1 month ago
@Zetality Hi Zetality, we flipped the LCD monitor of the 60D to the side and ran together with the runner!
SteadiProductions 1 month ago
@SteadiProductions then how come so stable while you film and run?
rykalbapakkau 1 month ago
@rykalbapakkau Read the comment. It says shot using Steadicam.
ZonMng 1 month ago
@rykalbapakkau Read the info. It says shot using Steadicam.
ZonMng 1 month ago
Thanks for your support guys! Do support our passion for Singapore by sharing our video with fellow Singaporeans and also your International Friends!
Do follow us on our youtube channel & like our Facebook page
SteadiProductions 1 month ago
i see my neighborhood! <3 the vid. thanks.
bajero 1 month ago
The video was very well flimed. It shows a lot of planning and effort putting in.
Unfortunately the guy in the video don't looks like a runner. He got no running style. Should get a real runner that glide like those Kenyas' long distance runners and with proper running attire. Then this video will be a very captivating one. Showcasting our beautiful island.
cityhousefly 1 month ago
pruss wan for awesomeness
weedee88 1 month ago
Thanks so much for producing this clip. Even when I'm out of Singapore, it feels home watching this.
eclipsingly 1 month ago 2
great job..makes me feel like running too!
auzistar 1 month ago 2
A wonderful production gues... well done! I love it!
avongxay 1 month ago
awesome stuff they should have shown this at NDP 2011.
neon0mega 1 month ago
Awesome video! Shows that there are still some places left that I've yet to explore in Singapore. :)
AshrafSpore 1 month ago
Lovely video :)
I do agree. There really is a lot of beauty all around, a lot going on on this little island. The ironic thing is that I didn't grow up in "that Singapore" - I never went to Kampong Glam or Little India as a kid. I discovered these places as an adult, and I like them because they are evocative of bits of local history that're exotic to me.
lkaiping 1 month ago
Amaaaaazing. Looking forward to RTS2 - The places we missed during RTS1.
astrodotsg 1 month ago
This is the best video that STB never produced. Also a very lovely paean to Singaporeans.
piggnant 1 month ago
this is awesome! it was fun guessing which part of SG he was running thru! Im based in KL now, and even tho Im in a neighbouring country, i dont get to go home often enough. Now this has put a huge smile on my face on this lovely Sunday morning. Good job guys. a simple concept but well executed. :)
fidahrashid 1 month ago
Locations are all jumbled up and the guy didnt perspire at all makes it a little weird. BUT nonetheless awesome effort made <3
faithloh1 1 month ago
Pandan reservoir! 2.4km run for rv students :)
athena149 1 month ago
might have worked better if the guy didn't run like a girl.
saetria 1 month ago
Very very nice! The guy looks like he would have done a pretty good marathon time. How did his hair stay so perfectly coiffed during the run? ;) BTW what official run did he run through when he was at the Padang?
enp01sg 1 month ago 2
Comment removed
sirspiff 1 month ago
Wow!
fujie94 1 month ago
this is da bomb:DD
niebuhrnobfear 1 month ago
who in the right mind will dislike this vid?!
tans0249 1 month ago
RUN FOREST RUN!!
therepublicist 1 month ago
The credits section wrote "Unmarked Guitars" -- I think that's a mistake.
muhammadhirman 1 month ago
So many nice places that I don't recognize! Good job with the video.
Arktos08 1 month ago 2
Awesome!
muhammadhirman 1 month ago
Take how long to complet the run :)
georgeporky 1 month ago
@georgeporky It took us 6 months to film this =D
SteadiProductions 1 month ago
wa lao eh, I wanna do that, but I can't run further than 100metres
IAmNotFatdotNet 1 month ago
yet another production from ruicheng and team. i like it :D
ibeee 1 month ago
omg i saw the park beside jp and boonlay shopping centre! LOL.... nice one!
marshtuber 1 month ago
any one can tell me wad that 2 song name ?
iphone4999 1 month ago
@iphone4999 It is in the video description, just click on the 'Show more' tab..
odomisauq 1 month ago
did he run to the zoo? where did you find this guy, NO SWEAT!!! HAHA but this is an awesome vid. the editing was great, the music was great, lighting. BRILLIANT!!!
i wish i'd thought of this.
stjap19 1 month ago
@stjap19 Yo! Nope we did not run the Zoo! Thanks for Supporting us =)
SteadiProductions 1 month ago
@SteadiProductions will look forward to your up and coming video.
stjap19 1 month ago
okay who wants to plan a running route based on this video?
jkai27 1 month ago
Overall it's awesome, the songs go very well with the video as well. kudos to your efforts. I have a humble suggestion, maybe next time can feature local music ? Especially those local indie artistes like 53a and Inch Chua. Trying working with them if possible, it would be mutually beneficial for the creative industry here in sg. =)
odomisauq 1 month ago 2
@odomisauq Hi odomisauq, yes it would be great to work with local indie artistes! It was our original choice to use local music in the first place, but lack of time to source and work out details meant using The Jezabels, who are really good :) If I had a choice, definitely local! Thanks for the band suggestions!
SteadiProductions 1 month ago
By the way, I'd be sharing it with my family and other friends as well ;)
ff9garnet90 1 month ago
@ff9garnet90 Hi ff9garnet90, thank you for the support!
SteadiProductions 1 month ago
Wonderful video =).Give me a tight feeling to my chest and make me feel that, once again, I'm proud to be a Singaporean. Great job guys =)!
ff9garnet90 1 month ago
This is beautifully done. :D
Does anyone know what the building at 05:19 is?
geeksomeguy 1 month ago
@geeksomeguy 5.19 is Orchard Ion =)
SteadiProductions 1 month ago 2
Lovely video. But wai u no support local music :(
plovery0 1 month ago 2
@plovery0 We will definitely do that in our next video :)
SteadiProductions 1 month ago
IS HE FOREST GUMP?? he looks like he runs funny.
jilun 1 month ago
2 people are foreign talent.
kenilim 1 month ago 35
awesome video. gives a warm fuzzy feeling inside especially for those overseas who are missing home. =)
linkingd0ts 1 month ago
Great concept! But found the guy bowing at both the Kranji War Cemetery and Civilian War Memorial a bit strange (esp for the civilian war memorial- considering it's a commemoration of those who perished during ww2) Overall, nice video!
plxn 1 month ago 2
Comment removed
plxn 1 month ago
Comment removed
plxn 1 month ago
Well done. Makes me feel all warm and patriotic inside
johnsmith1330 1 month ago 2
Yes!
DotaLord1993 1 month ago
this is lovely, Happy Birthday Singapore :))
ghostbabe38 1 month ago
Great video! If we put all our political affiliations and typical Singaporean cynicism aside, we can take a step back and actually notice that we have a rather beautiful country. Makes me miss home a wee bit. Happy birthday, Singapore! Lots of love from Pittsburgh! <3
Eghhhh 1 month ago 2
Darn got to rewatch it for the scenic shots I missed. Spent too much time looking at his chest
yardypoop 1 month ago 22
@yardypoop cuz his chest says zoom?
zhiyang434 1 month ago
This is a nice and creative video, but a little too long. Nevertheless well done
vinvgohg 1 month ago
very well done guys!
wubefrub 1 month ago
This is one of the most beautiful and touching videos I have ever watched as a Singaporean.
1337hacks 1 month ago 2
@1337hacks Thanks for your support! HAPPY NATIONAL DAY!!
SteadiProductions 1 month ago
Nice work Jason! Glad that I met you last Sunday :) (60D Battery grip eh?) See you again soon!
aochengsu 1 month ago
Great job on the video. With all that is happening in Singapore now, somehow your video has made me proud to be a Singaporean again. Thank you. Happy National Day
daniel7521 1 month ago 2
@daniel7521 Happy national day to you too! Thanks a lot for your support! Let us all be proud of our beautiful country and show it to the world!
SteadiProductions 1 month ago
heeeeeeee
doggie1993 1 month ago
also @5.43 would have been awesome if they jumped on that passenger bike and filmed it, would be nice to add a little comedy in it :)
thesoftmint 1 month ago
i like how he doesnt sweat at all
endot 1 month ago 5
@endot its the shirt XD really =D
SteadiProductions 1 month ago
Wonderful video! Thank you so much for your time and effort making it, I really appreciate it!
Living overseas, I never realised how much I missed Singapore until how emo I got when watching this. I really teared up after all the different scenes that I've personally walked and been in.
Fantastic job :-)
rinaz 1 month ago
@rinaz Thanks!!! Do check out the google map for the locations so that when you come back to visit Singapore again! You'll see them =)
Do share it with your overseas and show them the Beauty of our Country!!
SteadiProductions 1 month ago
Happy National Day to All! Do lend us your support for our simple project by sharing it with all your loved ones and international friends too!
SteadiProductions 1 month ago
Wow, on the faster scenes, the steadi-cameraman must really have quite a strong arm D:
wksim91 1 month ago
@wksim91 Our director Jason need a lot of arm training just for this HAHA
SteadiProductions 1 month ago
This is a really wonderful video. (Personally I would have used Martin Solveig's 'Ready To Go' song for the music but that's just me). I thought I knew most of Singapore but you have shown me a lots of sites I have yet to visit! THank you! Also, having the map of his run is very helpful. Can't wait to use this info in my next visit this December!
TorontoViewer 1 month ago
@TorontoViewer Thanks for your kind words! Do lend us your support and help us to spread our video around!
SteadiProductions 1 month ago
Man I was hoping he would run on the water from Ubin back to Changi Ferry Terminal. Disappointed.
chelidagreat 1 month ago 2
I was thinking he could have swam back to sg.
a1beng 1 month ago
Awesome vid! But why go from jurong to woodlands then back down to gombak then to ang mo kio. Lol.. It's not consistent. But the other places are all linked and consistent.
xiangyao1 1 month ago
@xiangyao1 Haha! We tried to somewhat ran a complete round but its quite difficult to link in the end
SteadiProductions 1 month ago
what about Pulau Tekong mate!
Overall an awesome job guys =)
tohwushu 1 month ago
@tohwushu LOL that place can't be filmed sadly
SteadiProductions 1 month ago
Danny MacAskill - "Way Back Home" go check it out. the video uses the same song and its also about this man cycling around somewhere. (as opposed to a guy running)
ngzhongqin 1 month ago
@ngzhongqin Yea! we got inspiration from that video too =)
SteadiProductions 1 month ago
Comment removed
ngzhongqin 1 month ago
is he wearing a bra?
thesoftmint 1 month ago 2
@thesoftmint No the actor is not wearing a bra =.=
SteadiProductions 1 month ago
@SteadiProductions haha i just kidding, nice video anyway, althought u should get a shot of tekong, quite a intresting site tbh, i am sure that if u asked u might have been able to do it.
thesoftmint 1 month ago
@thesoftmint lol now that's all i can see!
omgsianz 1 month ago
@omgsianz Thanks! Help us spread the msg =)
SteadiProductions 1 month ago
Great job Mr Tan! Now I know why you are all that busy during our SAGE rehearsals. :D
Thanks for your support and guidance albeit your busy schedule!!
andrew651992 1 month ago
@andrew651992 Help us spread the love in JJC too!
SteadiProductions 1 month ago
how many months it took to make this video? :O
mingz 1 month ago
@mingz It took us 8 Months in total, 6 Months to carry out the filming =)
SteadiProductions 1 month ago
That dude didn't run through Singapore
firdaus125 1 month ago
@firdaus125 Well we didn't literally ran through Singapore on foot, but we indeed travel through almost every single part of Singapore!
SteadiProductions 1 month ago
Great work. why not geylang...
mock83 1 month ago 4
Hey There! Thanks for your support! We did film geylang but the scene didn't turn out nice unfortunetely
SteadiProductions 1 month ago
Friday, October 21, 2011
When you think it's impossible
Mr. Hu is a big guy, 183 cm and 81kg, this will make his performance even harder.
Beautiful Things:
beautiful video,
chinese,
inspiring video,
life is beautiful
Wednesday, October 12, 2011
Smile because life is beautiful - 2
Beautiful Things:
beautiful picture,
beautiful smile,
cute picture,
life is beautiful
Tuesday, September 20, 2011
Cute song for beautiful you
LYRICS:
Chorus:
Today I don't feel like eating Fish and Chips
I just want some curry instead
Don't feel like eating pasta cold
These asian noodles smell so old
So today I'm gonna feast on this curry
All night long...
Nave:
I'm gonna pluck some curry leaves
And put em in my pan
Add chicken breasts
And mix with my hands
Nobody's gon' tell me I can't
This chicken curry
So yummy
Tandoori turns me on!
John Bala:
Now there ain't no curry like a chicken buryani
Cause a chicken Buryani don't smell
I just dropped in with my nephew named Vin
Cause the bugger isn't fed too well...
Vini:
Nave this curry is great
But I need a pappadum
Better than a steak
Screw the burning in my bum
I could eat this every single day
Yes I smell it
I gotta get it
So spicy all night long
Beautiful Things:
beautiful song,
beautiful video,
cute song,
cute video,
life is beautiful
Saturday, September 10, 2011
Smile because life is beautiful - 1
Beautiful Things:
beautiful picture,
beautiful smile,
life is beautiful
Saturday, August 20, 2011
Beautiful Voice, Beautiful Soul
[Korea's Got Talent] tvN 코리아 갓 탤런트 Ep.1 Sung-bong Choi
It doesn't matter who you are, as long as you have a dream, persist it.
Comments:
I heard he went to Art High School, but he could barely graduate because of his financial problem. I bet he couldn't get private lessons or support for his vocal training.. I admire him even more!!!!!!!!!!
I seriously cried when he started singing.. just wanna give him a Huge Hug!!
Bring it on Sung-bong!!! :)
I am really proud of you as a Korean. God bless you.!!
this young man is truly inspirational..well done..god bless you..all my love to u from Australia...
I sometimes think that this new media technology is just a little too much, but then I see something like this , which without this techonology I would never would have had the pleasure.... Wow! you may not have been blessed as a child, but you have been blessed with talent, I hope you find the road to success and recognition through your amazing gift, many hugs and blessings from Australia!
so unbelievable. good job bro, you're amazing.
I am a classical singer, and a Filipino. I want to extend my heartfelt thanks for this wonderful 8-minute story of inspiration. It made me proud to be Asian. Praise God for wonderful talents like this. More power Sung-bong Choi, more power KGT.
He touched my heart as he sang from his soul. What a gifted singer
It is the soul, crafted by Sung Bong Choi's trials that lend beauty to his rendition of Nella Fantasia. Comparing him to a Sara Brightman only proves his talent but the two are very different, not that he is better - his is a wonderful performance by its own merit. Music, it heals the soul and I pray his life turns around for the better.
If some respectful Korean organisation opens a bank account. I think millions people in the world will donate to change his life!
I'm really a FAN on him ..
you maybe made us cry , but those tears are the signs of our expressing that we are happy for you though your a loner , you fight for your future , you never give up .. people are very very proud on you .. keep up the good job. !
thanks for inspiring everyone ..
Choi Sung Bong has been in two major car accidents when he was young, and since he couldn't afford the payment then, he left the hospital. Now he is still undergoing treatment in hospital to make up for that. Each time he visitied, he sang opera to the fellow patients and he has been on the newspaper for that some years ago. God Bless
Lyrics: In my imagination I see a fair world, Everyone lives in peace and in honesty there. I dream of souls that are always free, Like the clouds that fly, Full of humanity in the depths of the soul. In my imagination I see a bright world, Even the night is less dark there. I dream of souls that are? always free, Like clouds that fly. In my imagination there exists a warm wind, That breathes on the cities, like a friend. I dream of souls that are always free, ...
this one's really amazing, same as with paul potts and susan boyle of Britain (try watching them too) they all have in common, unexpected but incredible amazing talents, they are all gifted. God is really equal loving us.. superb..
Beautiful Things:
beautiful korean,
beautiful video,
beautiful voice,
life is beautiful
Tuesday, August 9, 2011
Beautiful Voice, Beautiful Male Singer
Hope this song can brighten up your day.
Beautiful Things:
beautiful singer,
beautiful song,
beautiful voice,
life is beautiful
Monday, August 1, 2011
Greatest Marriage Proposal EVER!!!
Comments:
so cute <3
tjsm143 13 minutes ago
Thank you that’s so nice to watch something positive like that these Days!
Best wishes from Switzerland!
AnnickCC 15 minutes ago
wow... high five for originality :D
Ah19934 28 minutes ago
I thought it was super cute that she could tell it was her boyfriend as soon as he started talking :]
sarahlamppost 32 minutes ago
That was beautiful!
Hehechea 40 minutes ago
omg ! i love this video :)
Mafiachiqkone 56 minutes ago
I cried like a bitch, this was gorgeous!
RicaDominicana 1 hour ago
umh ok that was a cool proposal i will say.
but can we watch the movies now???????
jackal1001 1 hour ago
rare guy! <3
MissRizG 1 hour ago
SO SWEET!!!!!!!
MissRizG 1 hour ago
this was uploaded on may 16th .. and on the same day i proposed my best friend (girl) got rejected though :( .. .. and i didnt even know that when i was so sad.. somewhere in the world was happy like never!! i feel very happy for matt and ginny , i hope i will get "my ginny" someday ahead in the future.. on a may 16th .. in some year
harry140813 1 hour ago 2
girls stop trying to be impressed into marriage.. its gross.. not to mention false.
ihfppl 1 hour ago
omg that was soooo sweet. love it.
MizzNana112 1 hour ago
This has been flagged as spam show
BV10707 2 hours ago
Comment removed
BV10707 2 hours ago
CONGRATS !
itsracheel 2 hours ago
What is the song that plays in the end?
RosanaLobs 2 hours ago
@RosanaLobs Lets get married - Jagged Edge
jigga599 1 hour ago
WOW! Thisis the best wedding proposal ever in the history of wedding proposals. There's really no point in trying to think of a better one and for all us guys out there but to just get on one knee wherever and just pop the question. This guy Matt planned the best and greatest wedding proposal ever but he spent all this time and energy that there's no way he can top this and plan his honeymoon better than this lol. Great job Matt and God Bless both of you in your life long marriage :)
Dec2three198five33 2 hours ago
Congrats to both of you! Ginny your a lucky woman, hope i find my "matt" someday :) p.s. whats the song that plays in this video?
tans90 2 hours ago
He should start planning anniversary ideas
XitemeM 2 hours ago
They will be divorced in 2 yrs !
LOSERS!
mcbloomin 2 hours ago
the black guy in the back just wants his fucking movie LOL
stallionspride 2 hours ago 2
The first I've seen is right after church.
tylus101 2 hours ago
What a real pimp! this guy is a creative genius!! wit a twisted mix of hip hop haha.. gotta love this!
e1krimez87 2 hours ago
ke buena onda, que buena sorpresa, todos por un momento querriamos algo asi :)
alexgrungelee 2 hours ago
I want this.
Dawk20 3 hours ago
Yes, this is not the best, but is the sweetest moment for matt and ginny, this is the best start for them, and wish everything will be better and better. You both are the best in your own way!
louiss168 3 hours ago 3
THEN ALL OF A SUDDEN...hip hop music. X^p
sudynim 3 hours ago
holly crap wen i get married i want him 2 do this
Susan5nah 3 hours ago
Hopefully when its my turn and I do this no one will remember this.
TheTornadoStrikes 3 hours ago
those poor people who just wanted to watch the movie
theundersudy 3 hours ago 2
Aw. I was on the edge of my seat when you were on the way to the movie theater. BEST BEST BEST proposal hands down. God bless. (:
ULTiMATESYNCERE 3 hours ago
The things men will do for some pussy...
razorhanny 3 hours ago
@razorhanny exactly. It really isn't that important.
CMcFreeze 2 hours ago
That guy is the fucking man!
omgshesdead 3 hours ago
how much did u pay for that?
Cesartripe0 3 hours ago
the black guy in the background when they are hugging and stuff is just like - what the fuck is going on here i came to watch the hangover!
Maadsnake 3 hours ago 9
Real cool. Now there are gonna be copycats wasting my day doing this same thing when I'm at a theater to watch a movie that doesn't suck.
sorijin 3 hours ago
Yeh Boy Wooooooooooo
Waagyu 4 hours ago
lol it was ok i guess
xDarkcynx 4 hours ago
HOLY F*** THTS SO ROMANTIC AND IM ONLY 11 WOW
koolvids09 4 hours ago
Can't wait for part 2 : The Divorce
Magicthename 4 hours ago 19
@Magicthename why'd you have to ruin the magic of this? this is why the world is so hopeless.
oldwarplanes 1 hour ago 3
@oldwarplanes yea i hope everything goes well for them but thats a hilarious comment. made me laugh after i cried like a school girl bitch
FinFags 29 minutes ago
@Magicthename lol this was a really great idea and i thought it was really nice of him but that comment is quite hilarious
FinFags 30 minutes ago
i'm a straight guy, but my eyes went teary while I was watching the trailer part
flydanieltv 4 hours ago
i hate being single :(
aussiery 4 hours ago 9
awww...that was just the sweetest thing! congratulations you two! talk about doing it the right way.
sweet808bebot 4 hours ago
ok that was a cool proposal but did she end up watching that movie???
UrFavouriteTroll 4 hours ago
LOVE IT!!!!!!!!
niki2717 4 hours ago
wooo so sweet *.*
idknow2012 4 hours ago
This has been flagged as spam show
MyPoem4u 4 hours ago
PS... don't pay attention to the naysayers and negative opinions of others. Simple: JEALOUS!! Congrats again
COGICHolyGhostwitnes 4 hours ago
can you guys sit down so i could watch the movie.
Thank you.
Great imagination.
good job
Frijo1 4 hours ago
Sir, this was the greatest... def making it harder for all the young bachlors out here! But, you've given me, a young man, a standard and goal to shoot for!!!! Blessings and best wishes to both of you!
COGICHolyGhostwitnes 4 hours ago
This was awesome, but almost exactly the same as mysteryguitarman's.
carvver 4 hours ago
@carvver Ok I get it. guitarman did this already. Now can everyone stop posting about it?
CMcFreeze 4 hours ago
@CMcFreeze Hey, it's not some conspiracy to annoy you, i was just commenting on the video.
carvver 3 hours ago
This has been flagged as spam show
MyPoem4u 5 hours ago
The universal intro footage is used at the beginning of his video. Now isint that illegal ?? :p
Wedding proposal Gone Bad! FAIL!!!
KUSHALRAHA 5 hours ago
@KUSHALRAHA no actually, It wasn't used for commercial purposes, so STFU ;)
DarthLuke6 5 hours ago 3
@KUSHALRAHA dry.....
Deecimal 4 hours ago
genius!
chinchin05 5 hours ago
This has been flagged as spam show
7xXSE7ENXx7 5 hours ago
This has been flagged as spam show
MyPoem4u 5 hours ago
If I were her, I would speak less and pay more attention to the proposal movie and smile or cry more :P
Hitsugayamegumi 5 hours ago
this guy just made 12 million men mad! lol
wakeup186 5 hours ago
This is the most AWESOMEST marriage porposal EVAR!! XD
Madcat717 5 hours ago
My honey better come up with something this brillant... I LOVE IT!! CONGRATS!!
Selenas101 5 hours ago
is this great escape in stockbridge,ga?
melissa6295 5 hours ago
I think the popcorn bit could have been left out....
mitchamus 5 hours ago
@wgamador
hey you started it son. and your telling me that theres a girl naked in your bed, and your on youtube?
right...
rachelovesyoulots 5 hours ago
yeeeaaaaa boiiiiii!!!1
1337superboy 5 hours ago
It was cute until the AWFUL song they chose after she said yes. Absolutely killed the mood. Otherwise, very awesome
LivyLovesTCR 5 hours ago
Hats off to you Matt! Wishing that you guys keep making each other as happy as you were in the video for the rest of your lives!
shamsulshaikh 5 hours ago
I admit, I cried like a baby lol. Very well done!!
princesslulu1 5 hours ago
Everybody wish for d greatest marriage proposal. ;)
Mrderick32 5 hours ago
Yeah, very nice, whatever...
davidpoiu62 6 hours ago
BRILLIANT!
EvanEatYou 6 hours ago
This actually made me tear up!! This is definitely one of the most unique and adorable proposals I've ever seen or heard of. It's woderful! Best of luck to you both.
ellinachka 6 hours ago
who can out beat this one??? this is epic
hydrofizzful 6 hours ago
soooo sweet, i never cry when watching sad n romantic movies n all but ds really moved me!
hydrofizzful 6 hours ago
@mstenacious1 I see your point. I didn't pay attention to all the Facebook and Twitter stuff before.
ilovecoke23 6 hours ago
matt you're awesome! Ginny there's no way you could have ever said no after that proposal! Congrats :)
IWent2BandCamp 6 hours ago
congrats!
ldeahaddad99 6 hours ago
i jacked off to this ... i'm so emotional right now.
phpfanboi 6 hours ago
5:08 YEAH BOY
dh3684 6 hours ago
Mystery Guitar Man do this before!
But, this is still good! Congrats!
BG4X 7 hours ago
Bravo Sir Good Form :D Good luck yall
digitman117 7 hours ago
Assista LEGENDADO em portugues /watch?v=6WMDcwUAVL4
EuAssistoJustTV 7 hours ago 4
awww this made me cry!! SO SWEET! Congratulations!
cheer7blondie9 7 hours ago
yoh dude i would like to do like this its just great i dont have words to discribe my feelings man love it
mo786sonia 7 hours ago
Wow this is awesome and very inspiring. It inspired me to do something loving and creative for my proposal. God Bless:)
Naeolden 7 hours ago
BEST PROPOSAL EVER-3
RoriSutton 7 hours ago
Very Touching! Good job!
singtoyou52 7 hours ago
That's adorable! :)
nikishah90 7 hours ago
Very original & romantic. Made me teary-eyed.
princesaplastica 7 hours ago
What a D-bag, i mean good for him for coming up with something original but please don't put this shit on youtube. now every bitch in the world thinks her boyfriend/fiance/husband is an asshole because he didn't have a dozen people help him ask her to marry him.
justin7803 7 hours ago
This is by FAR the BEST wedding proposal in history! I was in tears while I watched this. (: She's lucky to have such a sweet guy. Best wishes to them (:
thee1Laura 7 hours ago 60
Wow cant watch this without crying, thats just sick...
Waldquelle187 7 hours ago
this is absolutely adorable...best proposal ever. <3
kaitlynxd9 7 hours ago
at 4:00 it's o fortuna
THEMASSHOW 7 hours ago
AWESOME
Hotty95394 7 hours ago
Soooo adorable and creative! Girl you are so lucky!! Made me cry.
Hockey11VR 8 hours ago
What was the name of the music at 3:15???? And 4:00? Anyone plz?
DreadfulControversy 8 hours ago
@DreadfulControversy The song is made by Michael Scofield - Why the bitch dont fart loud enough to make me go poopie.. its a great song
shinyralle 7 hours ago
@shinyralle Michael Scofield is from Prison Break. Stop being useless for once, but I guess that would be a hard task for you.
DreadfulControversy 7 hours ago
I agree, this is the best proposal ever.
xoxoBadRhymerxoxo 8 hours ago
What was the name of the music at 3:15????
DreadfulControversy 8 hours ago
cutest thing ever<3
michellenicolex 8 hours ago
I love "Is there makeup under my eyes??" TOOOO Cute!!! I'm uber jealous! <3 The best to you both!!!
misskamgam 8 hours ago
I wonder what happened to Fast Five!
ankitojha30101990 8 hours ago
The 2,400ish people who dislike this should be car bombed
11Lemonz 8 hours ago
2,427 people are mad because their proposals werent this good
iowabowhunter96 8 hours ago 94
wow... that's setting the bar HIGH.
ThereseJag 8 hours ago
This has been flagged as spam show
ultrajasonlolx5609 8 hours ago
Bravo.
KlonDikeChick 8 hours ago
:) :) :)
cheerstars1001 8 hours ago
what song is it at 3:48??????
marianalucia1000 8 hours ago
@marianalucia1000 Its Oh Fortuna from the Carmina Burana. Its in latin.
jbecknz 8 hours ago
@jbecknz thanks :D
marianalucia1000 8 hours ago
where is the bed scene???....hell no...i want the complete movie...
hbrabim 8 hours ago
i think i heard some guy scream MAKE LOVE. lolwut.
MushieAndMe 8 hours ago
This has been flagged as spam show
ultrajasonlolx5609 8 hours ago
AWW :']
WannaGoToKorea 8 hours ago
Looking forward to see how original their wedding will be :)
TheMikke 8 hours ago
this is movie is very,very nice!!!!
gogy9598 8 hours ago
This has been flagged as spam show
ultrajasonlolx5609 8 hours ago
I would cry so much.
Awwwww~ <3
kitkattcassy 8 hours ago
The smoothest guy ever....
isurf777 8 hours ago
Best proposal everrrrrrr Ginny is pretty lucky. What a creative fiance.!!!!!! Best wishes for thé couple and you have to upload a video of the wedding!!!
sunsetofnemesis 8 hours ago
So, WONDERFUL, couldn't stop smiling the whole time!!!!!!!
DzzRed 8 hours ago
Carmina Burana was a bad choice...
Koldovader 8 hours ago
She got that tank top at Target.
kitkattcassy 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago
Are they still together??????????????????
brainwashedserb 9 hours ago
@realmofsilence What's the matter with you? You don't know absolutely nothing about me or my bf! You say I'm shallow haha.. You don't know me at all! So please SHUT UP! You don't have anything else to do than being here judging people? Talk is cheap man! Stop talking nonsences and get a life please..
xxelizabeth24xx 9 hours ago
This is nigger shit
Apoc897 9 hours ago
whats the first song that is played? the one where the guy is asking the father for permission. if someone tells me they pretty much saved my life cause i neeeeed this song
Michkins1 9 hours ago
@Michkins1 I'm pretty sure it's the instrumental version of Marry Me by Train. Great song! :)
KayLikesMuffins 9 hours ago
i hear this song in every epic moment!! what's the song called at 3:46 ?
H0lY3V1L 9 hours ago
That was great. :3
clonecody45 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago
awww! so friggin sweet!!!!!!
Nit3shade21 9 hours ago
FAKE !
TrollinOnMyFace 9 hours ago
OMG THAT IS AMAZING AND SO SWEET
ILuvMyMusic4569 9 hours ago
love it!!!!!! congrats!!!
missvoncile 9 hours ago
Click on my video to find the truth of where Jennifer Lopez's
song "On The Floor"
Came from and how poor civilians were treated in making of this song and it's origin!
Mindofownz 9 hours ago
she must not like him at all
iAfterShock 9 hours ago
Does she still like it up to the right??
GKEV604 9 hours ago
what song is that. i want to learn it on the guitar please tell me
Michkins1 9 hours ago
fake.
iDeanne 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago
what a romantic proposal
darell724 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago
i shag her before this guy
Camuchoide 9 hours ago
CTFxC's was better, sorry.
DAlLYBOOTH 9 hours ago
Yeah.. at the movies... sooo romantic...
TheNoxiousReggie 9 hours ago
how much did it cost for the threatre to play it?
GKEV604 9 hours ago
WOW
GKEV604 9 hours ago
That was fucking awesome.
FeelingAnonymous 9 hours ago
AWHHH<3 THIS SO TOO ADORABLE <3 :3 + CONGRATZ!! 8'D
BestAngelFriends 9 hours ago
@wgamador Lmfao. Alright there, I'm sure that was your intention from the beginning. I'll leave you to what you want to think.
Liight2 9 hours ago
I love the way he set this up, complete with the action sequence and Exorcist-style music. Kudos to you, and good luck with your wedding!
OddballExtreme 9 hours ago
Matt, you're killing us out here man. Topping this is going to be difficult.
wardah0 9 hours ago
SONG AT 3:48 TO 4:35? THAT ODYSSEY MUSIC OR W/E?@!!?
EagleLineProductions 9 hours ago
@EagleLineProductions that's "O Fortuna" i think...
AshiteratsuAka 9 hours ago
that's really cute.
mmmikeyxx 9 hours ago
Be funny if she said no
1MarioTheMartian1 9 hours ago
Awhhhhhhhhhhhh -3
rebekahirish 9 hours ago
Beautiful to watch. Wishing you a long and happy life together!
sandismith2 9 hours ago
INCREDIBLE! Ginny is such a lucky girl to have such a sweet guy like Matt!!!!! Best of luck to you both with everything and have a long, happy life together!
truedancergirl 9 hours ago
was this the one in henry county
treyflyer 9 hours ago
lol aku nk kawin ngn pompuan jrmn
logelamutp 9 hours ago
If I were that woman I would have cried out all the water in my body. This is BEYOND perfect!
juliacarone 9 hours ago
You're such a bamf
3800GTV6 9 hours ago
This makes, the traditional marriage proposal's look like shit. :/
cheoleo2500 9 hours ago
haha that is the best thing i have ever seen!!!!!!! I LOVE THE SLOW MOTION PART!!!
Shiver161 9 hours ago
HOW CUTE !!!
And on my birthdaay :D
Banda2fly 9 hours ago
hahah the black man at 5:08 is so jelous:P
tutut37 10 hours ago
this is absolutely amazing. <3
lemonademouthlovers 10 hours ago
He got laid that night
Dibsing 10 hours ago
HEY EVERY
Saftey4Life1 10 hours ago
"Do you want to marry me?"
- "Shshh, I want to know how the movie ends!!!"
DallasGreen123 10 hours ago
2 years later.... they got divorced
h8stupidppl 10 hours ago
this is the most beautiful couple i have ever seen i wish you all the best what i wonderful way to start your new lives together
vixenchild28 10 hours ago
holy shit thats legit
MrKills12 10 hours ago
did they watch a movie after?
avrgboy 10 hours ago
@mysteryguitarman
avrgboy 10 hours ago
lovely
davetteZR1 10 hours ago
This has been flagged as spam show
thomasne 10 hours ago
God bless you two!
Matt, always look at her as the bride she will always be, even though it's true that she will be your wife. You're a blessed man.
M0ofi32012 10 hours ago
you're so romantic!!! congrats!!! i hope you can stay together for ever!!!!
LauritaVanessa04 10 hours ago
She is so lucky!!!!!
Actionnelll 10 hours ago
I wanna see my f-ing movie.
mckinnonderek 10 hours ago 23
LOL @ black guy 5:37
He's like AWWW HELL NAWW where's my movie!?
lyn18mkw 10 hours ago 56
this is the most thoughtful marriage proposal ever. i would die if someone proposed to me like that. <3
loverdearest11 10 hours ago
ahhhhhhhhhhhhhhhhhhhhhhhhhh so FUCKING CREATIVE ¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡ CREATIVE + ROMANTIC = BEST PROPOSAL EVER
juncodelrio15 10 hours ago
anyone knows the first song? the guitar fingerpicking..
thomasne 10 hours ago
@shadowX50 haha It actually took me awhile to figure out what u said
Pandasmash1230 10 hours ago
Didn't Mystery guitar man do this? but this is still awesome. Congrats!
Zxyquz 10 hours ago
Whew! Am I glad I got married 17 years ago! This guy set the bar high! Congrats!
scottb326 10 hours ago
yeee
rwing34 10 hours ago
This guy ruined marriage proposals for men everywhere
jedimastersolid 10 hours ago 4
I really want to know the name of the song in the minute 4:15
javonete96 10 hours ago
@javonete96
O Fortuna - Carmina Burana (Orff)
lizdena 10 hours ago
SO CUTE!
bebexrochelle 10 hours ago
Stop setting such high exceptions for marriage proposals!
Now the rest of is are screwed!!!!!!
NoobWithNegativeKD 10 hours ago
so sweet <3 <3 <3
khanhkute89 10 hours ago
Imagine if she had said no...
nicholasperry56 10 hours ago 2
WOW that is the sweetest marriage proposal I have ever seen!! I wanted to tear up just by watching her being happy!!! ^_^
reneroxx 10 hours ago
:'D
TheSchweetGal 10 hours ago
this is definitely the most creative and thoughtful proposal i've ever seen!
sweetcheekshoney 10 hours ago
Wowwwww super original!! Lovely couple! I hope in the in the wedding show some dances or something like this...happy ever after!!
Nikolitapr 10 hours ago
That's soooo awesome!!!! Congratulations to you both!! May you both have many happy years together!!!
K8tina 10 hours ago
I can only imagine if she left to go to the bathroom during this.
victim21 10 hours ago
cool
weirdpapaya 10 hours ago
Crazy awesome and adorable!
1hugaday 10 hours ago
Thank you, Mr Romantic, now I have to BUST MY FREAKIN ASS whenever I'm going to propose. DAMN IT
gorgurus 10 hours ago
no mames... que original... mmm haber si la aplico jejejjeje
edermio 10 hours ago
The man!
unknownrafe 10 hours ago
This has been flagged as spam show
ultilink3 10 hours ago
DAAYUM dats awesome how the hell did he do that?
TheTempestGames 11 hours ago
the dude at the enddd is wearing a ramones shirt! xD
XoBeAtLeBaBe101 11 hours ago
can someone plz tell me the name of the song between 3:47 and 4:38
ultrajasonlolx5609 11 hours ago
@ultrajasonlolx5609 la fortuna
jonpaul784 11 hours ago
cool vid. The awkward moment when she says no... Anyone on this site has an opportunity to recieve 50% or more off at local sales and make money aswell. No finance details needed. Click the link if your interested, and dont click it if your not. Simple. phillnz.thecustomeradvantage. com
nrlrugbyleague 11 hours ago
esto si es amor + babillas = amor eterno :')
toroyaris 11 hours ago
guys, now you know how to do it,
dont dissapoint us, sincerly,
all single women
jj, though this is amazing, if she loves u she wont care wat u do (mostly)
Jcrparamore 11 hours ago
yo thay was gay styll
JAAATTIII 11 hours ago
@realmofsilence deeeer god I was saying that as a joke.
mvaldezdz 11 hours ago
Aw, that's precieuse... T_T :D
DeathNoteOwnerTooBe 11 hours ago
@mikerowaves
i watched that video and honestly yes it has a better quality video but this one was alot better
TheArtObsessed 11 hours ago
This has been flagged as spam show
MyPoem4u 11 hours ago
another fake marriage proposal viral video? ...
exam 11 hours ago
Can we get this off the main youtube screen please? It's taking up too much of my viewing space.
scientolofag 11 hours ago
What a story to tell the kids and grandkids, it will forever be in cyber space for them to watch
angeluise1971 11 hours ago 3
@patbull..jagged edge-lets get married
jboogiemomma23 11 hours ago
@jboogiemomma23
WOW!! Thank you so much, wish you have a nice day!!! *dance*
PatBull76 11 hours ago
Copied mysteryguitarman :/
DjDannyTV 11 hours ago 4
This has been flagged as spam show
MyPoem4u 11 hours ago
So cute! Congratulations to you both!
vdacruz 11 hours ago
@vdacruz touching i give it that i mean that was amazing
TheSoltrain2011 11 hours ago
@TheSoltrain2011 yes.. touching is a better choice of words.. sorry I never made a comment and didn't think people actually read them lol
vdacruz 11 hours ago
@vdacruz brought a tear to my eye to see her reaction i do wish them well for there future
TheSoltrain2011 10 hours ago
thats pretty good!
MrShakDaddy 11 hours ago
@goboenomo What I meant by 'Alpha' was that you tried to seem like 'Dude, I get bitches on the reg man, they don't deserve this'.
If he didn't really love her as much as he showed in this, I would 100% agree with your first comment, that WOULD be too much work just for a chick that he DIDN'T love.
Sure it's a dick move for him to do that in some ways, but in other ways it's the 'Greatest Marriage Proposal EVER!!!'.
iProfessorOAK 11 hours ago
This is the most sweetest thing anyone has done that I've ever seen. She is such a lucky girl. Can u purpose to me too? Just so I can feel lucky like that? Jk. But bravo that's so sweet! Your vid is one of the best I've seen on here for romance I give you two thumbs up from me, my husband and my five kids. Congrats and live life before you have kids cause I know I didn't. Lol but wow still can't get over it. Can you guys do that for other people too? Not the same thing Like a movie theatre but
wendyyaj85 11 hours ago
This has been flagged as spam show
hpbjkr 11 hours ago
This has been flagged as spam show
MyPoem4u 11 hours ago
cutest couple ever! congratulations! :)
xoxo
platinumpinkice 11 hours ago
who sings the last song and what´s the name of it?
PatBull76 11 hours ago
This made me cold, and shiver, the good kind :) the ones that give you goosebumps :)
dudenoway96 11 hours ago
I but some of the people there we're like yeah good for you now shut the f@#k Up
kindaintheway 11 hours ago
lol the people watching the movie was probably like wtf is this... can i just watch my movie now.
dnnsdoable 11 hours ago
She was pregnant and the Father forced the poor lad... (Only kiddin')
That was great.. Even bought a tear to my eye.
Beatlesruleok 11 hours ago
This has been flagged as spam show
MyPoem4u 11 hours ago
Austin Linegar how r u?
Delta9rome 11 hours ago
DO or DIE
Delta9rome 11 hours ago
I must admit, out of the majority of these I have seen, this is the cutest, most unique one yet, Congrats :)
Zirus101 11 hours ago
what is the of song at the end? it´s fantastic...
PatBull76 11 hours ago
I love it! AWESOME!
martinimix79 11 hours ago
what a wanker.. and marriage is for the crazies!!!
MrJoshuaBolster 11 hours ago
that fiasco must hav ruined so many ppls night
DrChitta 11 hours ago
congrats to you guys! ginny you are such a lucky girl =)
kyouyanagi 11 hours ago
The bar on marriage proposals has officially been raised!
Kuorosh1 12 hours ago 47
@Kuorosh1 Than I guess we're playing limbo!
Hobble 9 hours ago
bravo my ass
FatPPlNeverMakeIt 12 hours ago
This has been flagged as spam show
MyPoem4u 12 hours ago
awww he is the sweetest person everr
rachelxoxo1000 12 hours ago
He got laid that night..
FuckTheSystsem 12 hours ago
This has been flagged as spam show
aacard01 12 hours ago
wonderful
aacard01 12 hours ago
if i was there i woulda kicked the guys ass for not lettting me watch my damn movie
damzeni1 12 hours ago
@damzeni1 you wouldn't have been there since the theater was filled with only their friends and family. I guess he's 'saved'
JonelleJNowak 12 hours ago
what if she was at a movie with someone she was cheating with
sinanyongacoglu 12 hours ago
how can she fucking say NO ?
Yod14Gaming 12 hours ago
This has been flagged as spam show
MyPoem4u 12 hours ago
2421 people's marriage proposal were rejected.
madhurpatel 12 hours ago 32
cuteeeee<3<3 she was sooo nervous... omg
CrazyTopfan 12 hours ago
This has been flagged as spam show
Yod14Gaming 12 hours ago
so who were all those people in the theater?
xxXDCXxxx 12 hours ago
@xxXDCXxxx nvm
xxXDCXxxx 12 hours ago
congrats
rubigal1 12 hours ago
ohhh they are so in love
rubigal1 12 hours ago
Every single girls dream inih?
haznii 12 hours ago
if she had say no, this would be called. "useless marriage proposal ever."
juanparty 12 hours ago
@juanparty congratulations Matt and Ginny.
juanparty 12 hours ago
Comment removed
JonelleJNowak 12 hours ago
cutest thing i've ever seen!!!! <3
paigeliviseth 12 hours ago
AWE <3
X3NevermoreX3 12 hours ago
Comment removed
JonelleJNowak 12 hours ago
And so they broke up a year later.
also lol sethrogan
kingbooforums 12 hours ago
You guys are adorable!
C1719 12 hours ago
This is cute but I have to say CTFxC has the best proposal!
gaarasrulestheworld 12 hours ago
This sucks
slabofmeatonface 12 hours ago
Wow! Nicely done!
GKEV604 12 hours ago
Thank you very much for sharing your special occasion. I enjoyed it very much and wish you both the best.
kank468 12 hours ago
This guy is my new hero!
HoveringDeath 12 hours ago
Typical American vomit.
jpgee19 12 hours ago
alilarter8 = you are a asshole. be happy for someone else. you really think you'd be mad that you had to spend 5 minutes watching a young couple proposing? what a sad life you must live...try relaxing and enjoy yourself...bet you have never and will never get married...PATHETIC WASTE OF SPACE
tomwadsworth25 12 hours ago
Beautiful beginning to a marriage to be filled with love. He surely loves you.
keeganob126 12 hours ago
This is AWESOME !!!!!!!!!!!!
mathGaud 12 hours ago
Lol, fail at 4:20 <-------- No pun intended pot heads, just a coincidence.
skepttix 12 hours ago
2418 people are fucking jealous!! may be they are not lucky enough to get married!!
ethanbd 12 hours ago
@ethanbd SERIOUSLY!!!!!
MsDarkrosebud 12 hours ago
Aaaawwww! :)
comeonego 12 hours ago
Omg that guy is soo sweet .
FrOotLooPs1O1 12 hours ago
what the music at 3:47 ???
anphux 12 hours ago
@anphux Carmina Burana ;)
Mejjcikeh 12 hours ago
@anphux O Fortuna.
rambammer2000 11 hours ago
@rambammer2000 how wuld i now
Delta9rome 11 hours ago
that was actually the best thing ever man
RXJ7 12 hours ago
SO LUCKY!!!!! I want that guy!! :))
Hellendeppsptfan 13 hours ago
@Hellendeppsptfan fuck u
jeffvin4 12 hours ago
@jeffvin4 Why??
Hellendeppsptfan 2 hours ago
oh wow who the fuck cares? Worst marriage proposal ever. ( and no im not jealous)
jeffvin4 13 hours ago
2417 people are pissed their proposals will never be as good.
JAWDAYFuddles 13 hours ago
jagged edge was the cherry on top
lk0micho 13 hours ago
lol, what if she said no...
TheDJBeets 13 hours ago 52
@TheDJBeets thats what the sequel is for :D
MagemanE5 13 hours ago
@TheDJBeets >.>''
Comicios 11 hours ago
The best proposal I've seen, and I've looked! Well done!
Ritercrazy 13 hours ago
BY FAR, THE BEST PROPOSAL I'VE EVER SEEN :)
HeckYessRachel 13 hours ago
2,417 people hate life and will never get married
Dasman86 13 hours ago
maybe is not the first and most original, but has some extra points...
-her reaction of :O when the trailer is showing
-the romantic kinda feeling of the begining plus comedy that follows and more xD
JuStViCtoR 13 hours ago 20
Absolutly awsome... :)
youaintshit77 13 hours ago
AMAZING
blightboy1 13 hours ago
LOSERS
horsemania1 13 hours ago
This is just great <3
MsRudeboy55 13 hours ago
This has been flagged as spam show
tahkis18 13 hours ago
This has been flagged as spam show
MyPoem4u 13 hours ago
That is definitely amazing!
Tori4Lif3 13 hours ago
This has been flagged as spam show
MyPoem4u 13 hours ago
That was really cool!!!!
OhanGeorge 13 hours ago
You certainly did make the movies jealous- along with 105,207 people.
Wish you all the best!! <3
BTW 2, 416 people are overly jealous and probably had their proposals by text.
<3 <3
DreamHope11 13 hours ago
This has been flagged as spam show
MyPoem4u 13 hours ago
This was the sweetest thing I have ever seen, but you know the sad thing? When a guy proposes to me in the future, it will never be as amazing as this one, because this video will stay in the pupils of my eyes.
Good luck Matt and Ginny <3 <3 You're the greatest couple EVER!!!
DreamHope11 13 hours ago
@DreamHope11 , well I think it wouldnt be fair for you guy for you to compare his proposal with this one, its the heart and feeling that he puts in it for you that you should be worried about. not all of us guys have the resources to pull that off. but kudos to the guy it was an awsome proposal.
bqtaspr 13 hours ago
Good one Matt, I wish the very best in your marriage..
bqtaspr 13 hours ago
I bet they had an extra 5-second clip in case she said "no," that simply went, "BOOM. Directed by M. Night Shyamalan."
VinylCyril 13 hours ago
This has been flagged as spam show
MyPoem4u 13 hours ago
nice..you scored some serious points with that bro. good luck on your marriage. This will be cool to share with your kids some day!!
baucomrj 13 hours ago
mnaahh, ever lame
extremetothemax86 13 hours ago
I was so expecting her to say NO!
Damn it.
UnexptedB 13 hours ago
like this KtdcqwUbuyY
kartmeraman 13 hours ago
this guy is boss
THEcomcastmaster 13 hours ago
Esto ya si hizo en España, bonito PLAGIO
kartmeraman 13 hours ago
good up until the jagged edge and run dmc song. :/
JeffW1231 13 hours ago
MysteryGuitarMan did a proposal similar to this, but he got Chuck Liddell to be in the movie and the proposal was less epic.
OmgChrissx3 13 hours ago
OMG this is sooo cute!!! :) She's so lucky!!
LittlePrincess2404 13 hours ago
dennis du opfer
newkaynac 14 hours ago
wow!! the amount of work he did!! It was beautiful! ....but how did he get the cinema to let him?! :P
KerriThornton 14 hours ago
hehe...pretty innovative...got to give credit ....awesome!!!
rebelx4life 14 hours ago
That's pretty epic XD
AzureDarkGod 14 hours ago
cuuuuute
fmsjcmom 14 hours ago
Great!!
lluis1969 14 hours ago
That IS the greatest proposal ever :) Lots of luck in your marriage!
xxxPurpleSkullxxx 14 hours ago
MGM was first.
deville487 14 hours ago
This was WAY better than Fast & Furious 5...
IlkaZapata 14 hours ago
woow
Dikadulguun 14 hours ago
That is sooo cute(':
EmziZZZ 14 hours ago
aww !(:
nefariousnatassja 14 hours ago
50% chance it won't last, but good luck.
n91htmare 14 hours ago
@n91htmare 50 % chance you die today, 50 % chance you eat at the restaurant tonight etc .. stupid
qcking666 14 hours ago
This has been flagged as spam show
bamafan6108 14 hours ago
What the fuck is up with those apple spam bots?
pezus 14 hours ago
@holamissmusica lol.. ohhhh... makes sense now why i didnt hear any negative remarks in the background..lol
MrMac415 14 hours ago
@JuStViCtoR thanks!
123yuser 14 hours ago
Awesome proposal, could'nt stop the water works...
guess im human LOL
fvrrljr 14 hours ago
Top marks for originality. Good luck to you both :)
fallyhag 14 hours ago
its very beautifullllllllllllllllllll
CHAWY79 14 hours ago
what's the name of the song at 3:46?
123yuser 14 hours ago
@123yuser o fortuna or o verona dont rememer wich one, is the same that jackass 1 intro movie
JuStViCtoR 14 hours ago
Comment removed
rambammer2000 11 hours ago
Comment removed
123yuser 14 hours ago
i find kinda cute the girl with glases that is in tha theather selling, who is she?? name at least? xD
JuStViCtoR 14 hours ago
aha this is on the news right now :L x
Ashiikax 15 hours ago
Oh Mein Gott IST DAS GEIL!!!!!!!!!!!!!!!!!!!!
privileg 15 hours ago
just broke up with my girl which I loved so much, she broke my heart....and watching this movie proposal makes me feel like shit!!! happy for the couple!!!
djaiseman 15 hours ago
just think what a disapointment and waste of money it would of been if she sayed no OMG
EpicCodClips3 15 hours ago
sooo cute =)
sehdah 15 hours ago
just wonderful....every gye should do this.....
alb378 15 hours ago
nice idea but video soooo long, waaaay too long
they will soon visit a divorce site
DivorcioDirect 15 hours ago
BEST PROPOSAL EVER!!!! That's my kind of marriage proposal :D
94RockerChick 15 hours ago
This is awesome. Im happy for both of you! Watching this makes being single suck lol.
flute1234 15 hours ago
This has been flagged as spam show
MyPoem4u 15 hours ago
THIS IS EPIC!!!!!
philialle4supra 15 hours ago
That was sweet :)
tbsguyguy 15 hours ago
OMG! how sweet is this?! when i saw this, i started to cry :) CONGRATS!
Jinni1706 15 hours ago
ok, leaving apart the fact that marriage is an ill concept in general, this video ain't that bad :) seems like the guy is quiet excited :)
gerailabai 15 hours ago
That was incredibly inspiring
TakeErEz 15 hours ago
someones gettin a bj after that proposal....
kiw321 15 hours ago 4
Just...wow. Congrats, this was hilarious!
TheNexus18 15 hours ago
This has been flagged as spam show
MyPoem4u 15 hours ago
what is the title of the song @3:49???
TheDaryl143 15 hours ago
BUUUUUH! We wan't to watch the movie!
serj88 15 hours ago
This is so sweet, it's funny, and touching. I am very happy for both of you, from Vancouver, BC. Congratulations! :)
JBitzz 15 hours ago
This has been flagged as spam show
MyPoem4u 15 hours ago
fuck the haters! this was AMAZING! congrats you two! I'm sure you'll have a great and long life together :)<3
amyxobrittany 15 hours ago
even though ima guy i cried a bit cuz this is so fucking sick. congratz to them
DEAN66DIME 15 hours ago
whats the "one more surprise"
VirginOfRape 15 hours ago
@VirginOfRape The entire audience were really her friends and family. LOL
TheNexus18 15 hours ago
The YouTube user MysteryGuitarMan did this type of wedding proposal before Matt did. Unfortunately, MysteryGuitarMan isn't getting near the recognition that Matt has, which is a travesty. Imitators shouldn't be given so much credit.
wolfshredder1 15 hours ago 23
@wolfshredder1
jealousy is speaking...
rockee77 13 hours ago
@rockee77 Your definition of jealousy is misinformed.
MisterDyer 13 hours ago
@wolfshredder1 you need to calm down -_- so someone else did something like MysteryGuitarMan why do you give a shit ? are you the one getting married ? no. so shut up and be happy for them :)
ToastTabby 13 hours ago
@ToastTabby he needs to "calm down"? he didn't overreact, he was simply stating that MGM was first.
SpartanW0lf3 8 hours ago
Comment removed
sideshift05 12 hours ago
how the hell is anyone going to top this lol this was awesome congrats!!
danman2626 15 hours ago
@ColdeyLive Looooool!!
Good one.
mrcritic1 15 hours ago
i love this soo much the worlds best marriage proposal...this so beautiful...im so happy for you guys i hope you have a long life of happiness!!
altrisha1 15 hours ago
Great Stuff... Great Minds Think Alike... Check Out "Purple Honey" on Youtube....
thinkcupid 15 hours ago
This has been flagged as spam show
MyPoem4u 15 hours ago
@kendract88 Maybe you cant find the "right man" because you suck? Personalty of a dead fly?
Ever thought of that? Not likely.
You probably think you're gods gift to man.
mrcritic1 15 hours ago 2
@mrcritic1 Judging by your comment you must feel the same way about yourself. But thank you for the compliment...I didn't say it, you did.
kendract88 15 hours ago
in tears :'-)
randomrelly 15 hours ago
TOO EPIC!!!
altrisha1 15 hours ago
Lol, I would probably die of embarrassment if this happened to me. A word of advice to guys who might be watching this: don't worry if you'd never be up for something like this. Not all girls appreciate grand gestures. Keeping it simple and intimate could be better.
KittyToKaren 15 hours ago
@Kizak6 I wouldnt expect that... that's just a reminder to somebody who think they do
btiarra 15 hours ago
@SmilingAlot MysteryGuitarMan did the movie proposal first, but Mattandginny was way better. Only thing cool about MGM was the proposal and Chuck Liddell. Matt had Ginny's dad and he made her cry.
tclark108 15 hours ago
This has been flagged as spam show
MyPoem4u 15 hours ago
12 million hits!!!!! what an amazing proposal
MONERN76 15 hours ago
wow.. that's awesome!!
haters gonna hate..
DisruptableGrandson 15 hours ago
This has been flagged as spam show
btiarra 15 hours ago
@btiarra
You're on a video with over 12 million views. How many of us, do you think, DO know your situation?
Kizak6 15 hours ago 2
wow thats one lucky girl
Jmacsexy 15 hours ago 2
I thought this video was downright adorable. I mean Matt did a great job and I think its wonderful that he felt the need to ask her fathers permission. How many guys would even do that? I'm so happy for you Matt & Ginny; May your life be full of blessings and joy. And may you have a wonderful life together. Congratulations!
ArtemisUrameshi 15 hours ago
@ArtemisUrameshi Yeah, how many guys have the resources to do that? Give me a break, and get over yourself. Seriously. I could just as easily ask that same question about girls. How many girls would even go that far to please a guy (not necessarily regarding wedding proposals)?
batterymet 15 hours ago 34
can some1 tell me the artist+single by the end of the song, i really like it, but i duno who sings^^. thanks.
Btw gz bro.
mdgysbl 13 hours ago
@mdgysbl its lets get married remix by jagged edge
ilyxchanel 13 hours ago
thanks man, youre great.
mdgysbl 13 hours ago
@mdgysbl
It's Jagged Edge - Let's Get Married. :-D
Lycheaa 11 hours ago
2411 people disliked to feel better, because they know they'll never get maried
This is beautiful, real love :)
0003Cat3000 15 hours ago 2
When does this movie come out?
KTWON1 16 hours ago 2
Awww... <3 <3 <3 This one made me teary-eyed. If I were the girl, I would have collapsed in my seat. This is just soooo romantic.
Keep the love alive even after the wedding!
zelpish 16 hours ago
génial mais alors génial romantisme pas mort ca c est une demande
surcouf169 16 hours ago
omg this was too addorable fuk the haters. that was romantic!
iMTOOGRiMEY 16 hours ago
I'm still fapping.
DipzG 16 hours ago
Why the hell is every1 crying while watching this o_o?
Keepin1tReal1 16 hours ago
2411 people have never been in love!
xxAMILLIONARExx 16 hours ago
2411 people had their partners leave them at the chapple
joelbailey23 16 hours ago
good thing i didnt do my eyemakeup yet :.)
Starsofneon 16 hours ago
How sweet
mndhemphill 16 hours ago
Amazing video!! Wishing you both well!!
c4mbl 16 hours ago
theres something wrong with 2410 people, how in the world could u dislike this
driftmcvey19 16 hours ago
Booooooooooooooriiiiiiiiiiiiiing.
Cassandre1986 16 hours ago
@Cassandre1986 Then you obviously don't deserve ti get married. It's very sweet and romantic and if you don't like it, then most probably you don''t have any feelings. How would you feel if someone special did this to you? Would you say it in their face that it's boring? Or thoughtless? Or lame? I KNOW I WOULDNT.
alilarter8 16 hours ago
@alilarter8 I would get mad if somebody makes me pay to watch that. I find it very selfish. People in the theatre have paid their place to watch a movie, and I am sure they do not want to be interrupted by some unknown couple getting married.
Plus, it is boring to watch.
Cassandre1986 12 hours ago
@Cassandre1986 Um, excuse me. You must be a pretty unhappy, b*tchy person. There is nothing wrong with waiting and taking, what, 2 EFFING minutes of your time to let these two people have a little moment. I thought it was amazingly sweet. I would LOVE it if my boyfriend did that for me. I feel sorry for your man....
MsDarkrosebud 12 hours ago
@Cassandre1986 the people in the theatre were all of her friends and family... she didn't realize it til the lights went up.... don't be so cynical and pessimistic. Calm down... read the second to last paragraph at this site: well i can't post the site, but if you go to thesun . co. uk and search "Dramatic movie marriage proposal goes viral" in their search bar, you'll see it.
JonelleJNowak 12 hours ago
En el amor todo se vale
homlac1 16 hours ago
The Universal intro made it look like the actual movie more than a trailer. Still a brilliant idea nontheless.
XFS540 16 hours ago
I cried. So, ver, sweet and touching :') Congrats you guys <3
alilarter8 16 hours ago
Awesome
tommytankvideo 16 hours ago
@kickermcdogg All I have to say is maybe you haven't found the right kinds of girls, I asked my husband to marry me while we were at a street fair drinking, I think part of it is that guys like to have the control.
beesting83 16 hours ago
where were the special effects???? there shoulda been explosions of love, and slow motion love bullets!!
GRIZZ2008 16 hours ago
This comment has received too many negative votes show
islandsylph 16 hours ago
You made her watch Fast Five? That must have put the moods down.
anunfittingname2 16 hours ago
awsome!
from bagdad with love!
wish you a happy life!
08jafar 16 hours ago
Just restored my faith in humanity! -Thanks! ☺♥☺
cooneyfriday 16 hours ago 2
thats freakin awesome!!!!!
Sebbz86 16 hours ago
THIS IS AMAZING!
TTTrixie 16 hours ago
Stole my idea :)
I uploaded on the 1st of March :)
Made a clip for a song "Running to You through the city".
dimka2hot4u 16 hours ago
@dimka2hot4u watch?v=tH2wv5HY3Y0
dimka2hot4u 16 hours ago
Not sure how to create a hyper link with my video but copy and paste in search bar
Joe's proposal to Alexis
2008joealexis 16 hours ago
Matt, you make the rest of us men look TERRIBLE! LOL, This was awesome, I pray that Jesus is the center of your marriage and that you always keep surprising your future wife! Good job man!!!!
rlxrandall 16 hours ago 2
This has been done before. Search for glomer8888 on youtube. He made something like this in 2008. Still very sweet though. Congrats to you both.
pinayperfection 16 hours ago
SECOND BEST PROPOSAL EVER!! I did the same thing three years ago. I just never uploaded the live version as I proposed to her while our family watched. youtube (Joe's proposal to alexis)
2008joealexis 16 hours ago
People are getting WAY too deep on this video. It's a marriage proposal not a sexism debate!
Video is beautiful, congratulations!
kathrynlanelove 16 hours ago
was there any outtakes of strangers in the theater shouting " GET ON WITH IT !! we're trying to watch a movie here GEEZ ! "
iluvmypet 16 hours ago
How cuuute!!! I told my boyfriend he has to live up to this video. :P So beautiful! Good luck with your future together! :)
frecklemonster20 16 hours ago
@realmofsilence Well, the reason why women don't do things is because those are the stadards society have placed on us. Being an indepented woman still isn't a hundred procent accepted, we are never really encouraged to take initiative.
millie1235 17 hours ago
@realmofsilence It's not about expectations; I assure you that this woman had no idea that her boyfriend would do this for her. It's a guy's choice, not obligation, to do what "he wants to do" for his girlfriend. If you want a someone badly, you go out of your way for them. And rest assured, there are women who do much for their men, however, it's only conventional for a man to propose. In my opinion, dignifiedmen decide when it's time to marry and make the initiative.
Zahra1 17 hours ago
Like a fucking bastard boss.
Logadc 17 hours ago
This is so sweet...Congrats to the both of them....
SavChaseAuthor 17 hours ago
That was awesome... and loved her faceial expressions... not many men ask the fathers permission anymore.. I wish you two the BEST of luck and many many years of happiness... Good Job Matt... now watch you started a trend and all guys will want to do it that way bahahaha
superniki36 17 hours ago
this reminds me of a song by children of bodom ... was it worth it ?? .... :P
sykhophaunt7 17 hours ago
ooouuuhhh, so sweeeet ! :D I love it <3
Gertiiee3 17 hours ago
This one beats mine. One time a guy had me use my talents as a mime (see vids) to proposal to his fiancée. He had me perform as a mime on the street, got me to use him & his girl in a wedding skit (she had no idea and just went with it). I played the pastor and "mime married" them in front of all the spectators. I had the real ring and flowers and gave it to her near the end. Once she realized it wasn't just a skit she FREAKED !
ETtheMime 17 hours ago
More views on this than mystery guitarman's proposal and its been out longer so it must be a copy.
MsJeffk1 17 hours ago
@MsJeffk1 I know :( MGM did some amazing and epic trailer and her girlfriend was soo happy!! he neded more credit than this one...
anaalfaro 9 hours ago
BORING MOVIE.
god604 17 hours ago
2408 people need to get laid
AlexHRocknroll 17 hours ago
nothing is original anymore, but they still made it very special
superpowergod 17 hours ago
Wait...soo there was no movie?
Luupz 17 hours ago 2
@Luupz
I would have asked for a refund, what a shit movie!
lacedboxa 17 hours ago
@Luupz OH OH wait just discovered the "Show more" button.
Luupz 17 hours ago
@kendract88 Good job contradicting your own post. But, I'll address your point anyway. If women want those "nice things," then they should also be giving those "nice things" in return, especially if you're going to be preaching about equal treatment. You can't have it just one way; otherwise, you're adhering to double standard logic, which in turn, makes your original point completely flawed.
realmofsilence 17 hours ago
@realmofsilence I should commend you for misreading all of my previous posts. I'm not going to dignify you with any more responses. :) For the record, I'm the one giving and never receiving.
kendract88 17 hours ago
@kendract88 I didn't misread any of your posts. You just couldn't properly argue your point, as it was already extremely flawed. So, of course, you act as if that's somehow my fault. Nice.
realmofsilence 17 hours ago
@realmofsilence I argued my points just fine, you chose to interpret them your way is all. That's cool though, whatever floats your boat.
kendract88 17 hours ago
@kendract88 Oh, yes, of course, I magically chose to interpret them my own way. Just keep running in circles. 'Round and 'round you go! By the way, I thought you weren't going to dignify me with any more responses? A change of heart already?
realmofsilence 17 hours ago
@realmofsilence Magic has nothing to do with it. And I lied. I'm enjoying your responses. It's quite amusing, please, go on.
kendract88 17 hours ago
someday!!!!
chuziechinkz 17 hours ago
this is sooo sweet. i have instantly become a fan of their love team. ^_^
iamqwertyprincess 17 hours ago
as we 16 year old dress flashy and call everything gay i admit this is quit good.totaly a good way to satisfy woman.
MrThereiscake 17 hours ago
OMG this is so damn cute!
Wiggyify 17 hours ago
This was the sweetest thing I have ever seen... I almost cried watching it. Congratulation you two! :) Everyone deserves to have a relationship like the one you two share :)
Taylorcn171 17 hours ago
Awesome! What a lucky girl! Congratulations!!
imsuprmom7 17 hours ago
nice creative idea for something that's supposed to be special, but putting it on the internet for view counts cheapens the whole thing
uclabruin07 17 hours ago
Pekneee
MrSilvo72 17 hours ago
Comment removed
OnlyQueeg 17 hours ago
I cried and i loved it, the only thing i didn't like was the final song...
andypavon 17 hours ago
THIS IS NOT ORIGINAL.
mikerowaves 17 hours ago
@mikerowaves But original.
OnlyQueeg 17 hours ago
@OnlyQueeg So something that was done several times before is the real definition of original?
mikerowaves 17 hours ago
@mikerowaves then not fake.
OnlyQueeg 17 hours ago
too sweet :o) loved it! congrats to the both of you
cherNstephen 17 hours ago
quite some comparisons with How I met your mother s05ep23 the wedding bride
Gaucho09vvc 17 hours ago
wow i can't believe i actually cried after watching this! congrats! :)
kevtom 18 hours ago
downvote for the idea being blatantly ripped off from MGM's vid
acbalingit 18 hours ago
2404 people have never really loved someone
madheadramzy 18 hours ago
FELICIDADES AMIGO-...... he estado algo triste, pero por cosas como esta AUN CREO EN EL AMOR.... MUCHAS GRACIAS ¡¡¡¡
licantropo2525 18 hours ago
this would be clever had another youtube video not been posted of someone who did this already.
mikerowaves 18 hours ago
@mikerowaves
what video would this be?
TheArtObsessed 18 hours ago
@TheArtObsessed It's actually in the list to the right under "The BEST movie theater proposal EVER!!!", posted by "andrewmanzano".
mikerowaves 18 hours ago
GO CANUCKS GO!!!!!!!!
myusernameistaken23 18 hours ago
Comment removed
PippaCreativity 18 hours ago
Nice, but you copied MysteryGuitarMan :P
SmilingAlot 18 hours ago 10
@SmilingAlot it is nice, maybe copied but he's made it his own :) and thats all that counts
PippaCreativity 18 hours ago
@PippaCreativity It's actually an exact replica of the other proposal. Just sayin' lol
SmilingAlot 18 hours ago
@SmilingAlot Thank you.
mikerowaves 18 hours ago
man no one can top this.
everyone is using "best marriage proposal ever!" as their captions
but this one takes the cake.
No body else has the right
BluntlyComical 18 hours ago
'sniff' 'sniff' soo touchin 'sniff' 'sniff'
bootybouncersFTW 18 hours ago
God bless u two- Matt and Ginny. U guys make an awesome couple!
cheers n have a good life together!
MrFrankrulz 18 hours ago
Congratulations!!!! I am so happy for yall that was very sweet.
mizudemon 18 hours ago
all you people complaining because men have to always take the initiative, just look at history. It's your own fault. Men always wanted to be superior and be the only one able to get a job. Therefore, you have to pay for everything. Get over it. If you don't like it, then don't date us. And I don't know about the other women on here but I cook and clean for my guy and I don't get crap in return. I put him first always and don't ever get the same in return...THAT'S why I can't find the right man
kendract88 18 hours ago
@kendract88 Ok, so, you're basically admitting that if the guy has the job and has to pay for everything, then the woman doesn't deserve to be treated equally. Got it. Of course, I'm sure you're going to say that's not true, but then you just contradicted your entire post.
realmofsilence 18 hours ago
@realmofsilence Actually that's not what I said. I said that's what you men have expected for so long but now that we want those nice things because it no longer represents weakness, you're all complaining.
kendract88 17 hours ago
looove it.!!!!!!! totally awesome.!
thenikhilkamra 18 hours ago
This has been flagged as spam show
MyPoem4u 18 hours ago
It was a beautiful proposal, it's not about what's expected of men or what women need to do be considered equals...When there is love and respect by both parties you want to give the other person your best. Because they bring out the best in you.
EsmiKC 18 hours ago
his wife is hot
TairyMrHesticles 18 hours ago
now thats cool
TheLordTroy 18 hours ago
what was the "I have one more suprise for you." ?? Anyways, may the future be the best for you guys. :)
MarioxLove64 18 hours ago
@MarioxLove64 the movie theatre was full of her friends and family!
ayethatoneaye 18 hours ago
This is unbelievable! Wonderful, congratulations!!!
marcioferroni 18 hours ago
What a beautiful proposal! Best wishes - you make a wonderful couple!
TheNewAgeGirl 18 hours ago
This has been flagged as spam show
ILoveTouYube 18 hours ago
This has been flagged as spam show
MyPoem4u 18 hours ago
Woow thats nice!
TheDisturbedMan 19 hours ago
how cuuuuuuuuute :3
MRScapatanaa 19 hours ago 2
I love it!! Awesome!! May God Bless your Union.
machellr 19 hours ago
I guess all that counts is that your girl likes what you did for her!! :)))
Jadeslippers 19 hours ago
awww
dannylynnforever 19 hours ago
Why aren't more men like this? Better question, why aren't more women in the kitchen making sammish's and grabbing me a beer?
ColdeyLive 19 hours ago 8
@ColdeyLive cause you're an idiot and clearly don't know how to treat woman ;)
xoxsingingxox 19 hours ago
@xoxsingingxox I'm glad that your a women and nobody respects your opinion :D
ColdeyLive 19 hours ago
This has been flagged as spam show
batterymet 19 hours ago 9
Comment removed
batterymet 19 hours ago
Omg Absolulity MindBlowing !! Lucky Girl ! Congrats xxx
StephanieLaura2010 19 hours ago
i..like..the..trailer!! <3 is it weird that this video made me cry? haahaha
ArynneVengeance 19 hours ago
MGM?
crundlepieofficial 19 hours ago
2401 are jealous girls who didn't have a proposal like this
TheOnlyRealJoker 19 hours ago 4
that's the best proposal!!!.... Congrats to you both! :D
rsts32 19 hours ago
That was funny... but it's AWESOME!!!!!!!!!
Yashwanth1996 19 hours ago
Para cuando el trailer de la primera noche de sexo!!!!!!??????
leydenpsp 19 hours ago
What if she says NO !
AlexTube95 19 hours ago
2,400 ppl thought the dislike like button was the "dis- i -Like" button!!
rudegal2020 19 hours ago 2
@rudegal2020 Not they didn't.
willywalls 19 hours ago
Lol Even if the movie isn't that great - that would totally be worth the price of admission! ;D
AlterEgox5 19 hours ago
This video was awesome!! It brought tears to my eyes very creative and funny too!!! thumbs up!!
shairaglows42 19 hours ago
2400 ppl might be gay or lesbian !!
Pasbara88 19 hours ago
@Pasbara88 no, they're just regular guys who were talked into watching this by someone.
daspolitbuero 19 hours ago
they did file for divorce last week.
daspolitbuero 19 hours ago
das cute...
MissTina993 19 hours ago
I love how he buys popcorn first... xD Lol.
RegenxKaulitz 19 hours ago
BEST EVER!!!
tomashcu60 19 hours ago
pretty blooody awesome mate. he wouldve gotten some sweet arse loving that night.
killallemovermin 19 hours ago
all the girls are like, "jealous" while the guys think "duh".
daspolitbuero 19 hours ago
this has already been done :/ but it's still sweet (:
blogursky 19 hours ago
Comment removed
2lucic 19 hours ago
this guy is EPIC!
Nev4rForgotten 19 hours ago
Matt this was the most brilliant and entertaining proposal I have ever seen!!Ginny has a wonderful guy!
2lucic 19 hours ago
awwee this is so sweet! I can tell you to truely love each other. :) Best of luck you two
5EmilyGirl 19 hours ago
el amor es creativo, jejej muy bien por ellos
HiddenExperience 19 hours ago
YOU ROCK DUDE !
rajaijaz007 19 hours ago
Just amazing!!
tamlynne2101 19 hours ago
What are the name of the songs, where he run and where she say "yes"?
wessleph 19 hours ago
awesome
drniel04 19 hours ago
Awwww!
lalaala12345 19 hours ago
This Rocks,.. Congrats to you both. Fantastic Idea Matt
love4musicnart 20 hours ago
Dude's legendary!
Drtast 20 hours ago
OMG, them apple people are so retarded, all there names like ends in a letter with a number before it, so stupid! all saying thanks with the same code name, dont fall for it people! :D Thumbs up for everyone to see!
Love this love story btw :')
jlo2k9 20 hours ago 2
was this staged?
nas6792 20 hours ago
How did they get the theatre to run this?
hallpriest9 20 hours ago
Congrats you two..... this was very original and I even teared up.....and im a GUY!!
kcs51777 20 hours ago
Great !! all the best for both of you
ndrymix 20 hours ago
didnt know chester benington had it in him
ConorNosThrill 20 hours ago
Matt you are a genius, just wondering now what you will have in store for your wedding! this really made me smile
JaineLV183 20 hours ago
...is that a 'small' popcorn??
NorHuxy 20 hours ago
@mvaldezdz And if you're a girl, you should do something like this as well and stop making the men do all of the work. If you want equal treatment in life, then you have to show it in return.
realmofsilence 20 hours ago 51
@realmofsilence there are women out there who propose to their men. and it's the guys decision to go all out for their girl, no one's forcing him to do so... don't be so freakin' discriminatin....
hard2pleaz 19 hours ago
@hard2pleaz Discriminating? Society has placed standards on men that they have to do these types of things. The man is always having to do everything he can to make the woman feel special. When does the woman do something? Also, there were women bitching in this thread about why more men aren't like this. You see? If anything, THAT'S discrimination. Why the hell is the man always obligated to go to these levels? As I said before, women have such ridiculously high expectations.
realmofsilence 19 hours ago 26
@realmofsilence These are stereotypes that society has taught boys and girls is expected of them since they were born; not every women is screaming for equal rights. If you don't want to be held to these expectations then date a girl who doesn't believe in them.... Although, are you willing to take a girls last name?
kimmietate03 19 hours ago
@kimmietate03 i know right, it makes sense for guys to propose and everything and on the day of marriage we girls give away our names for theirs. ..i guess these "stereotypes" have really just become something of an unspoken rule encouraged on both sexes....like why can't women propose and men give away their names on the wedding day, huh?
wootwoot937 18 hours ago
@wootwoot937 You're both missing the point. Men are always expected to take the initiative. It's not just regarding wedding proposals. Hell, we're expected to pay for everything, open doors, etc. Not to mention that we're the ones who are supposed to ask women on dates and dances. Then later, women complain about "not finding the right guy." Well, if there's a guy you like, then here's an idea: GO ASK HIM OUT YOURSELF. Otherwise, you have no right to complain about "not finding the right guy."
realmofsilence 18 hours ago 69
@realmofsilence They don't find the right guy in clubs. In clubs people are more interested in making out. That's why most of the nowadays girls don't find the right guy, also, they're stupid, they prefer a cold hearted guy than the sweet guys, they reject them, people want too much freedom, with a lot of freedom people can't be loyal and stick where they are. I didn't ask my boyfriend for anything, he did all by himself, and when we started dating, i gave him all of my love and retribution.
andypavon 17 hours ago
@realmofsilence i agree with you.. alot of women expect a man to go to these levels just to do this type of stuff.. then they do nothing in return.. i think it should be equal.. MEN HAVE FEELINGS TO YOU KNOW...
kickermcdogg 19 hours ago 14
This has been flagged as spam show
2lucic 19 hours ago
@mvaldezdz so, hows your love life?
voodoocigam 19 hours ago
This has been flagged as spam show
MyPoem4u 20 hours ago
best proposal that I have ever seen.
drwho269 20 hours ago
Red top is going "Can we play the movie now PLS?"
Cartyy 20 hours ago 34
aren't they going have a lot of extra cash from Youtube!!! CONGRATS!!
MsQuinnyb 20 hours ago
WOW people are so stupid and ignorant ---- i just got engaged and i think this is the cutest thing i have ever seen - each couple is unique and so is their engagement story! clearly yours matches your love for cinema! i, for example, got engaged on a beach, barefoot because that is what my fiance and I are into! best of luck to you and yours on your upcoming marriage!
DSilver117117 20 hours ago
guy in red t-shirt at 5:35 "START THE FUCKIN MOVIE ALREADY". :l
Kyukoji 20 hours ago 3
@btiarra Then, he should dump your ass right away for having such ridiculously high expectations. Women like you deserve nothing but the worst treatment in life. It's unbelievable that you could even say something like that about your own boyfriend just because he doesn't do something like this. What the hell have YOU even done that remotely compares to this?
realmofsilence 20 hours ago
@GDI109 Agreed!
realmofsilence 20 hours ago
This has been flagged as spam show
MyPoem4u 20 hours ago
this is super cool, im gonna do this to my future wife i SWEAR!
thekidwhowantstosing 20 hours ago
Iltasanomat (Y)
MrMirrro96 20 hours ago
@mvaldezdz That guy is right. Please enlighten us on what girls do for guys that even remotely resembles something like this or any grand wedding proposal. Go ahead, I'm waiting....
realmofsilence 20 hours ago
THAT WAS incredible bro....Im about to get engaged.....This was redic!!!!! best one I have ever seen
drwayal 20 hours ago
I cried!!!<3
ToniMariexo87 20 hours ago
How sweet! Congrats :)
PassionDragonFruit 20 hours ago 2
this is the cutest thing ever.. i hope i get proposed to so sweetly one day and not just at a football game or something
badass964 20 hours ago
damn I've been outdone!
seaton125 20 hours ago
This has been flagged as spam show
MyPoem4u 20 hours ago
Thanks keep them comming
bettyruns 20 hours ago
But how was the film?
MrHellothisisme 20 hours ago
2395 people are obivously hidiously jealous & never watched a romantic movie.
this proposal is awesome!!!! <3
banout7 20 hours ago
@DannyIgnite
Alright man I'm sorry.
ninearthify 20 hours ago
Thumbs up if the Carl Orff sequence was your favorite part.
warden1103 20 hours ago
This is the cutest most amazing proposal I have ever seen. Goodluck :)
-3
Aimzybabe1 20 hours ago
Awww! Truly awesome! Wish you the best of luck!
Makubex195 20 hours ago
i wish someone said: SPOILER ALERT, HES GAAAAAAAAY.
danieljkmorrison123 20 hours ago 2
When he hugged his to-be father in law, you can see tears in his eyes. What a fucking good video.
dannyboyinxs 20 hours ago
this is soo awesome dude.. wow.. makin wanna cry...i noe how u feel bro.. jus started dating this girl and we gonna have our second date this weekend but i love her already... cant wait to pull something like this for her
bigseksi1 21 hours ago
I so wanna rip that off! ahaha
hobbles477 21 hours ago
Well this was some self indulgent crap, not sincere at all. Seems like a set-up for youtube 'fame' with that oh so obvious message at the end and website in the description lmao.
CommentFanatic 21 hours ago
Im so jealous of this....I thought I proposed in a cool way !!
latinsatinsoul 21 hours ago
Thats just awesome! I am still laughing from stopping to get popcorn.
kaebug 21 hours ago
You are an amazing man, Matt!! It took great will and an amazing soul to come up with something like this.....UNHEARD OF!!!! This has made it all over the front page of MSN home page. I would not be suprised if you guys end up on national news over this. Makes me Really think I need to step up my game a bit!! Thank you, Thank you and many more thank you's. At this point you have already had over 12.5 million views, it must say something for what you did. Congratulations!
F4flight 21 hours ago
2395 people got left at the alter
chillitsagame 21 hours ago
wats the music in between the vid again?
xxNzw 21 hours ago
so supprise...
hoangvu9688 21 hours ago
I usually hate these things but this was truly the greatest I've ever seen. I wish you both the best of life's luck.
DarkKrush 21 hours ago
marriage is shit! you should live free
sothgunfil 21 hours ago
This has been flagged as spam show
noudzii 21 hours ago
amaaazing !!! luvd it
noudzii 21 hours ago
!!!omg!!! that was perfect.
wow
lucky girl..and guy lol
sam61133 21 hours ago
u callin' this shit the greatest? oh cmon man. there's even more greater proposals than this one. this is crap man
beacruzify 21 hours ago
@beacruzify Obviously you don't realize how much time, effort, and money went into this.
DJsnapp1e 21 hours ago
@DJsnapp1e u can have all the time man, and if it's just money ur talkin' abt here, then i could just give my girlfriend lotsa money then ask her to marry me.
beacruzify 21 hours ago
i find this difficult to masturbate to.
zacmatt8 21 hours ago 4
that is so awsome
ShaolinRyan 21 hours ago
What is the name of the movie they're watching?
babidji 22 hours ago
Start the movie already....
smokejump1 22 hours ago
that is beautifull
SkilZ2GrilZ 22 hours ago
this is the greatest marriage proposal ever!!!
MrAlbatros03 22 hours ago
i don't mean to be that guy but what if she said no
jahvan201 22 hours ago
@jahvan201 LOL AWKS AS
EnhanceWoW 21 hours ago
5:35 that guy in red in the background is thinking enough already...I ain't clapping.
aifusatiluj 22 hours ago
thanks 4 this page I got one!
bellemers 22 hours ago
way to go Matt....
fgalvaobrazil 22 hours ago
imagine the people watching. 'This is one fucking long movie trailer' lol.
flyingemuzZZ 22 hours ago 3
Pfff...The greatest? come on man.. what a disappointment. This is not even a new idea.
mrmojodadog 22 hours ago
PLAY MY MOVIE
HuCkDuCk 22 hours ago
This has been flagged as spam show
kulpreetg 22 hours ago
This has been flagged as spam show
kulpreetg 22 hours ago
This has been flagged as spam show
kulpreetg 22 hours ago
This has been flagged as spam show
kulpreetg 22 hours ago
This has been flagged as spam show
kulpreetg 22 hours ago
very nice idea! so sweeeeettttttttttttttttttttttttttttt
einalem007 22 hours ago
Who saw this in the headlines of MSN? :)
PrincezzLaurenLolz 22 hours ago
#criedlikeababy
jujubagirl 22 hours ago
Is it just me or is that guy's voice sound funny? Maybe it's just his accent.
dailylife100 22 hours ago
Wow!!!! I'm jealous!!! That's sooooo sweeeet!!!!
lucysg88 23 hours ago
Imagine if she woulda said no LOL!
drasent 23 hours ago
@drasent LMAO
truongphan90 22 hours ago
SWEEEEEEEEEEETTTTTTTTT!!!!!!!!!!!!!!!!!! ♥♥♥
keyofdead 23 hours ago
2387 people are just jealous or never have been in love.
This was awesome.
Misstiffanija 23 hours ago 2
Impresionante amigo !!! la mejor pedida de mano que e visto !!! desde menorca !!!! felicidades
dLa0811 23 hours ago
That black dude looked annoyed..
chriscr123 23 hours ago in playlist Trending Videos of the Week (5/20)
thật lãng mạn hihi
hantuyetka 23 hours ago
Thats sweet
7964harry 23 hours ago
Now lets just imagine she just said no.... awkward :/
BoyPaper50 23 hours ago
so cute. i teared up
BeautyScarz 23 hours ago
Every day people get married, but I pray that they make a difference.
rey1940 23 hours ago
This man more than deserved to marry any girls !!
t3eS92 23 hours ago
Congrats dude. You just made every other guy seem super mediocre. :/
kholl7 23 hours ago
holy fuk ginny is bangin'
HeshTatu 23 hours ago
woooooooooooooooow!!!!!
ElisaLoveWestIndies 23 hours ago
oh my goodness..this is the sweetest/cutest thing I have ever seen...congrats!! haha :)
jonassfann09 23 hours ago 2
This has been flagged as spam show
fatjim741 23 hours ago
This has been flagged as spam show
bmaxcey 23 hours ago
I know this is great, but umm what about the movie the people there was gonna watch, I'm sure they were annoyed after a while when a whole bunch of other people came in...
samuellis 23 hours ago
That was to flipping cure..
bmaxcey 23 hours ago
that is probably the cutest thing i've ever seen. you've got a keeper there, lady
Beccabear08 23 hours ago
This has been flagged as spam show
fpvvsford 23 hours ago
this is soooo cute...
mpscats360 23 hours ago
Comment removed
fpvvsford 23 hours ago
awww I wanna get married now!
sheronah101 23 hours ago
the best ;)
prince3argf 23 hours ago
my sister cried after watching this.
sebdlc1234 23 hours ago
Amazing...and the fact that they are playing "Jagged Edge" at the end is too funny.
aziajs 23 hours ago
this is soo nice :) congrats from Hungary! :)
trixy345 23 hours ago
great
guazas69 1 day ago
everything was magically perfect ... until he drove a ford *sigh*
NoBiggieJustMiggie 1 day ago 3
Their 2nd date and they are getting married? WTF?
SaconoWoW 1 day ago
@SaconoWoW He said "Since our 2nd date, Ive always been sayin , we were gna make other movies jealous"
Hence the title of the "fake" movie.. Making The Movies Jealous.. Did u even pay attention? Or were you getting popcorn?
UDpizzaguy1 23 hours ago
@SaconoWoW umm, are you retarted?
Nathanchooper 23 hours ago
Congratulations to you both! Best proposal I've seen. Love from Ireland. Xxx
Netty271 1 day ago
Type in Nick Satt and see funny music videos
TheAlbinoNegro 1 day ago
can I buy the movie rights to this?
silverd20 1 day ago
n'awwwwwwwwwwwwwwwwwwwwwwwwwww
TheLuv2drawanime 1 day ago
so when does this movie come out?
firehill56 1 day ago
ok that was good
r2dan 1 day ago
stupid place to to propose,
bigjake52 1 day ago
& everoyne lse is like 'WOOO congrats! wait what about the movie?"
astrotoadp6 1 day ago 3
Was hoping someone in the back would yell out, "Start the fucking movie..."
tvfilm 1 day ago 12
@tvfilm nah, i was hoping that when he went through that door, the screen would say " to be continued"
ZinXR 22 hours ago
@ChainX k
MisterBinx 1 day ago
@GAMEVIDZ12344 When someone does that for you, its hard to say no.
zGamerXz 1 day ago
lol it would be funnY if she said no
GAMEVIDZ12344 1 day ago
ok that was really good!! im crying :)
karaokegals 1 day ago
totally the best wedding proposal ever!! Congratulations to both of you!! I hope you will always be happy!!:)
ole9898 1 day ago 2
I siincerely hope the strangers were apologized for the delay on the movie!
HamoudyA 1 day ago
gay
sh3rro 1 day ago
The most epic movie trailer I've ever seen. Bringing 3d to a whole new level...
infinity579 1 day ago
AWWWW how romantic :D
pooney4 1 day ago
Awwww soMe :)
deadpool358 1 day ago
the marriage proposal bar just got set higher...
thlin 1 day ago 2
Wow...So yeah...She probably just got engaged to the most amazing person on earth ((:
iluvrimmel 1 day ago
omg so beautiful
MitzuYamazaki 1 day ago
crazy
lfes2k 1 day ago
Привет из России )))
нас поразил ваш ролик )
молодцы !!!! )
VenomRus48 1 day ago
привет из России )) наспоразил ваш ролик )) умнииицыы )))
VenomRus48 1 day ago
i would laugh if she said no! LOL
YourGamingXP 1 day ago
1 week, 12 million views, unbelievable like this movie.. very very nice :-)
suCKRRRRR 1 day ago
This is such a cute way to propose! I also got engaged this year and it feels so great to know who you are going to spend the rest of your life with :)
congrats guys! All the best!
BeautyDivineable 1 day ago
that was incredibly sweet!!!
LayByMySide 1 day ago
So are we going to get to see the wedding night movie when their alone? That's something I'd watch.
SteveTheSpaz 1 day ago
@SteveTheSpaz That Guy Got Mad Sex That Night.
FallenEmpireLegions 1 day ago
cool
cblpop 1 day ago
Comment removed
immaShitDisturber 1 day ago
This has been flagged as spam show
randomuserlfc 1 day ago
CUTE!
TrueStunnah 1 day ago
congrats this was so cool i did almost the same thing i hope to see more check out mine let me know what you think may you both have a long and happy life and congrats one more time GOD BLESS
rickmcinroy 1 day ago
Is this movie coming to theatres in Vancouver??
ismymikeworking 1 day ago
My friend posted it on me and our friends facebook, i love this so much! i wish it was a real movie! yall should be movie stars. i cried when i seen this! good job and you are one of the sweetest guys in the world, you are very blessed darlin..good luck to yall!
Aktippens 1 day ago
thats awesome .. shot bro
rangeo100 1 day ago
shes so cute....lucky he a threw a ring on that ASAP
kiddfabul0u5 1 day ago
So sweet. happiness
ktsduylinh 1 day ago
cute
Ridylan 1 day ago
good thing the world didn't end or this proposal would've been pointless
Izzdan 1 day ago 2
Zzzz...."Nice waste of moneyblahbalh" I think ppl who are going to watch that movie have been told about this proposal thing.
namasterchoma 1 day ago
That was a modern fairytale right there
BeautifulVampire123 1 day ago
WAY AWESOME CONGRATS!!!!!
projecrunway 1 day ago
That is so sweet
xxgwyloxx 1 day ago
As soon as the trailer started playing everyone else in the theater was thinking "This movie's gunna be SHIIIIIITTTT"
forkness9494 1 day ago 16
This is so cute. Happiness to the couple!
akmormongirl4ever 1 day ago
and this video will pay for the wedding, lolol.
HockeyDiane 1 day ago
This has been flagged as spam show
randomuserlfc 1 day ago
The proposal on YouTube, The honeymoon on RedTube!
TheNzCherub 1 day ago 9
fuck that would have been the worst movie to go on a date to.
WildLifeFantastic 1 day ago 11
i was expecting the top comment to be about the canucks
hardyboyztoextreme 1 day ago
shutup with all the "what if she said no comments". Obviously the guy has got to be confident that she is in love with him and that she was going to say yes before he did something like this. Your a fool if you do something like this for a proposal and your not 100% sure if your girlfriend even loves you or would marry you.
karmadtran 1 day ago 5
Can you guys do a vid about how you met and your story together soon??
abender08 1 day ago
love so much this trailer ... unique ... god 4 ur everything ...
chocofilling 1 day ago
12 mill views wow
invisibleyinvincible 1 day ago in playlist Trending Videos of the Week (5/20)
I almost cried that was so sweet good luck to you two<3
samiireaper 1 day ago
Wonderful! Who is this person, 2,380 ?
poweremsa 1 day ago
That is admirable!!! :x
MrHamDzui 1 day ago 3
There are 2,380 jealous movies.
jabrolter15 1 day ago 4
He wins, he get the pussy.
ronz706 1 day ago
@ronz706 grow up much?
CPPA 23 hours ago
Wow, I haven't cried and laughed in a long time, thanks guys!
jairave 1 day ago
lucky girl...:)
blackbelle87 1 day ago
This has been flagged as spam show
EnzoCheLatino 1 day ago
This has been flagged as spam show
Edwany1 1 day ago
Super tierno!!!, que chévere que aún existan ese tipo de detalles!!. Felicidades chicos!!!.
Hivanvv 1 day ago
I hate the two top comments.
EnzoCheLatino 1 day ago 2
i've posted the news in Spanish and will add the youtube link luck. allimimito com
Edwany1 1 day ago
This has been flagged as spam show
Edwany1 1 day ago
Comment removed
Edwany1 1 day ago
Great idea! Awesome execution !!! Perfect!!! I wish my BF would propose that way ;) or along the same lines :p
fashionistakitty 1 day ago
WOW!., I love it!!...So Romantic Man!!..,I've posted the news in Spanish and will add the youtube link luck.
Edwany1 1 day ago
3:47 - 4:38 o fortuna. best part ever
soulzterz 1 day ago
that.is.so.cute.
tjsofele28 1 day ago
that was mind blowing :D
supernijaorangejuice 1 day ago
wow...I`m romantic man, but this idea is the best i ever see...
vexa007 1 day ago 3
Damnnnnn so romatic
frenly74 1 day ago
i thought that someone would go like "what the fuck dude!? i wanna watch my movie!!!" nice btw congrats!
gordishosexy 1 day ago 3
ohmyawd, I wish I can do that to my future wife.
MrCwalkpeter 1 day ago
Damn!!That was interesting
Blankname101 1 day ago 3
He is the most interensting man
MegaDemonlover 1 day ago
it would be so awkward if she said no
JoshWallaceGC 1 day ago 4
Fake and Takei..
MoOtErFiCk1 1 day ago
GO CANUCKS GO!1
ravballer 1 day ago
now that a propsal
animenewbie420 1 day ago
why would someone dislike this
HughsieBoy24 1 day ago in playlist Trending Videos of the Week (5/20)
Im surprised all her girlfriends didnt tell her. :P lol jks. Very well done. Grats.
ShaneyPo0 1 day ago
THAT WAS MY IDEA|
jk congrats!
worldfamous09 1 day ago
NICE
cana2011da 1 day ago
The narration was so bad.
thenewdesignone 1 day ago in playlist Trending Videos of the Week (5/20)
This has been flagged as spam show
liamisocool 1 day ago
This is adorable :)
megbutlerschannel 1 day ago
2 years later.....divorce
pygame 1 day ago
didnt mysteryguitarman do something like this?
HeIIToAll 1 day ago 2
@HeIIToAll yeah and he did it better
MrFunnyEd 1 day ago
I bet the 2,377 dislikes were from film directors... They got jealous :P
DivineCards 1 day ago 3
I dont mean to be a party crasher, but this idea was stolen from MysteryGuitarMan's marriage proposal a few months back. Sorry :/ /watch?v=lBx3-A3mLD8
naes9999 1 day ago
why are there 2377 dislikes! this video was awesome!
lilcgurl20 1 day ago
imagine if she said no.
H3cTiCRaDiATiOn 1 day ago 4
They are getting a lot of money from the clicks hahah as wedding present =p
rycebabii 1 day ago
I don't understand why this has gotten so many hits. I'm happy for the couple, but really this whole proposal saga is just absurd and over the top.
italianpride888 1 day ago
Nice to see theres still romance in this world
Fieldy1800 1 day ago 6
awwwww
sweetpari1 1 day ago
how do i get this free ipad -.-
KingLoganTremblay 1 day ago
awesome man......
Ironhide104 1 day ago
GO CANUCKS!!
SpaceStation49 1 day ago 13
This marriage is brought to you by
FORD BITCHES!
ZachAndVedder 1 day ago
This has been flagged as spam show
juvecanada 1 day ago
5:10 go RAMONES !
0554005192 1 day ago
Mystery Guitar Man did this like... quiiiite a while ago...
alexyuzwa 1 day ago
orrrrrr, it made me cry.....Congratulations
MrTommytucker56 1 day ago
AWESOMENESS
scarut 1 day ago
DUDE. I came to see JACKASS 3D I PAYED TO SEE JACKASS 3D AND IM GOING TO SEE JACKASS 3D WHERE THE FUCK IS IT!!!
SuperMicklovin 1 day ago
why so much hate? congrats to the both of you, I hope you are very happy in your lives together :)
PabbyBoy 1 day ago
Best marriage proposal ever! By far the sweetest thing I have ever seen!
13TaraDise13 1 day ago
That guy's getting pussy tonight
MegaShiny 1 day ago
This has been flagged as spam show
scarut 1 day ago
This is a porno? Under the views its says
As seen on Pajarracos- Porno, Humor, Noticias Curiosas y Webcams Amateur. LOL
N3wbyB3wby 1 day ago
@Shedde16
I don't think it was actually a real audience, I think he had told a bunch of friends of theirs that he was doing this and told them all to be at this theatre, it was dark inside so she didn't recognize any of them. That's my theory anyway, a bunch of them came down to give her a hug and such so I think that;s what happened
EruptionRules 1 day ago
LOL this is so copied from the mysteryguitarman proposal!
elitescooby 1 day ago
@elitescooby Who cares...
samuel7897 1 day ago
sabes si hay algun video subtitulado en español, gracias
02ddi 1 day ago in playlist Greatest Marriage Proposal EVER!!!
This video succeeded! It made 2,375 people jealous!
BumblebeeSwift 1 day ago
maravillosooooooooo !!!!!!!!!
chacotopher 1 day ago
wouldn't it be funny if she said no
bxxx9 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago
This has been flagged as spam show
TheMrFreshPrince1 1 day ago 2
AWW HOW CUTE !!! CONGRATS
lalakimmie19 1 day ago
that's sweet. but i bet the people who actully WANTED to watch the movie were like cool story bro. now turn on the movie!
priya2598 1 day ago
damn that was awesomely unexpeted how'd he find the time to do that
KingKazma105 1 day ago
did the people end up watcher the movie that they paid for?LOOOL
shedde16 1 day ago
thats so awesome :)
angelADuae 1 day ago
This has been flagged as spam show
Amanda2184han 1 day ago
Hey everybody, if you wanna watch something cool check out our video. Remember to give your rating. Thanks!
MyPoem4u 1 day ago
it make me cry....congratulations guys
athena128551 1 day ago
wowww 12 million
4lifecopt 1 day ago
I wish you the greatest life together.
Fankarlin 1 day ago
This has been flagged as spam show
TheyCallMeWendy 1 day ago
What if she said no....
TheReapersWay 1 day ago 4
@TheReapersWay Then they don't get married... Common sense bud
xSchneids 1 day ago
I LIKE IT. wonderful
thanhvanphongdinh 1 day ago
This has been flagged as spam show
ThaRealMsWayne 1 day ago
Very unique .. let's hope he's that enthused in 10 yrs lol.. my bf prop 2 me on hall.ark crd- - that was unique too! I still hv the crd n it's been 40 yrs..
mistylatteable 1 day ago
love this!!!!
wittchimp 1 day ago
i wonder what every body else was like
TheThenerdanotor12 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago
Mistery Guitar Man Proposal Idea!!!
gunacopter 1 day ago 3
I like it! It's so romantic!
kilunore 1 day ago
Thumbs up if you hate people who ask for thumbs up
FOODMONST3R 1 day ago
@FOODMONST3R SHUT. THE. FUCK. UP.
Branos93 1 day ago
Hey! Sit down im trying to watch the movie!
FOODMONST3R 1 day ago 4
It was very original but the rest of the people there must have been like: " seriously? Grats and all but I payed to see the movie not a family get together"
MariaChikitita 1 day ago
what if she's on a date with this other guy while the trailers goin
Shazzamnwithoutus 1 day ago
so touching
jamesbz19 1 day ago
haha, did some one shout get lost at 5:09
gmwphnehn 1 day ago
Congratulations! Perhaps I'm a sap but this was fantastic!
:huggles:
tarlah 1 day ago
I was overjoyed n cried... Awesone
vontan72 1 day ago
That guy in the back was like "WTF when does this movie start?"
O8adk 1 day ago
@O8adk u clearly didnt realize that the audience was everyone they knew ....
emotioNrgX 1 day ago
how rude to disrupt the movie that the rest of the audience paid to see...
OobydoobBanoubie 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago
After this he'll never know if she really loved him for him ...
HelloMyNameIsBob977 1 day ago
OKAY WHY ARE THERE THOSE FREE IPAD ADS EVERYWHERE??? I HATE FRIGGIN SPAMMMERS GET LOST.
ImHumgry 1 day ago
@TheBMXStreetlife fuck off troll get a life dickfaced lunatic
whitepeoplesuckass 1 day ago
Okay so how did he do that???
Suesbob 1 day ago
thats fuckin aWEOSME
bobtheforth 1 day ago
Omfg this was the cutest marriage proposal ever!!!
I started crying when the dad gave his daughter's hand in marriage to matt
I hope if i ever get married i can get a proposal as awesome as this :)
dxroxxx 1 day ago
@dxroxxx And let's hope you do something equally as awesome for the guy you're with. A lot of women out there have such ridiculously high expectations, and they fail to return the favor. If you don't get what you want, don't bitch about it, because most likely, you were the source of the problem.
realmofsilence 20 hours ago
Awwwww
ScottPilgrimXRamona 1 day ago
i wii do something like that, but with a new lady..never with my wife,,,hehe
1922eduardo 1 day ago
what was the movie
MizeryCinema 1 day ago
2372 people got rejected when proposing because their gf's "wanted it to be like matt and ginny"
CarnageMerc 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago
....That kinda made me cry...Haha xP I'm way to sentsitive!!!
AnimeFreakxDMuchx3 1 day ago
swag.
t1mTV 1 day ago
not bad... pretty original and well made...
TheLostProphecies 1 day ago
lol you can tell he has a lot of money..
tommy20464 1 day ago 2
@jakkes96w was the ipad thing real? can u message me the site if its legit ? =]
Poncho707 1 day ago
@Poncho707 Its not legit, its fags tryna get attention..
jordan5168 1 day ago
omg thats so cute!
BeautifulinSanityx13 1 day ago
cute <3
GrimmjowJaegerjaque0 1 day ago
wtf? so theres no movie
tuber52 1 day ago 2
So How am i supposed to One up This haha congrats man. My girlfriend is gunna hate me though if i cant come up with something almost as cute
kaysaps 1 day ago
@kaysaps Well, then she doesn't deserve you. A woman who is that greedy deserves nothing good in life.
realmofsilence 20 hours ago
How could there be ANY dislikes at all for something so sweet!!??
This isnt making the movies jealous, this is making ME jealous....
jordanpruittjuli 1 day ago
I was waiting for her to say no
chvick 1 day ago
Оригинально, красиво. Такое признание на всю жизнь запомниться. Лишь бы не кончался "запал"
LirisNSK 1 day ago
Oh my, that's adorable. Congrats on the yes.
ToBeAVampire101 1 day ago
it sucks for the guys who took their first date to that movie.... raising the bar man...
laughing31 1 day ago 6
well he kind of set the bar for marriage proposals pretty fricking high so it's going to be a challenge to beat that
BlazyNonVevo 1 day ago
LMAO 3:09 Great Proposal
Extreme105 1 day ago
This has been flagged as spam show
shreder89 1 day ago 6
@shreder89 he looked more like "say what! no movie dog?" xD
Made0fStone 1 day ago
This has been flagged as spam show
kulpreetg 1 day ago
This has been flagged as spam show
kulpreetg 1 day ago
WHAT IF SHE SAID NO?
HISTORY WILL BE MADE.
GO CANUCKS GO
Cherub217 1 day ago 5
/watch?v=c7G5m302AiM ....watch an AMAZING MW3 TRAILER (all rights go to infinity wards)
That1SpawnCamper 1 day ago
i bet this guy made alot of girls around the world hate their bf's for their types of proposals XD
Spdking7 1 day ago 2
Why didn't he run on the wall at 3:50
meh
RickyMossip 1 day ago
GO CANUCKS GO!
canucksftw7 1 day ago
Comment removed
3dpcman 1 day ago
This is... wow. :') made me cry.
bbyd0ll1 1 day ago
GO CANUCKS GO!!!
ravballer 1 day ago
IF YOU DISLIKED THIS YOUR A HATER!!!! this is beautiful
Olusmakingmoves 1 day ago
people who propose in front of crowds are lame
engela2 1 day ago
@engela2 I think it's adorable...:/
DarkGates8 1 day ago
@DarkGates8 what if she doesn't want to marry him? No pressure, right?
engela2 1 day ago
loved it, i reckon this has got to be the cutest and madest proposal everrrrr!! meannn!! <3
HAZBRO17 1 day ago
hahahah that black guy in the red shirt..."wtf i paid 12 bucks for this" hahaha
ps no offense to black ppl
NYGPiNoY 1 day ago
@NYGPiNoY lmao
tiBbLeX 1 day ago
this is HILARIOUS
/watch?v=htHOXVLhmcw
thumbs up so everyone can see
thanks for your support :)
kulpreetg 1 day ago
This has been flagged as spam show
kulpreetg 1 day ago
Comment removed
getsilly222 1 day ago
@getsilly222 ... more proof most woman are greedy roots!
tiBbLeX 1 day ago
@tiBbLeX true my friend, very true!
getsilly222 1 day ago
Way to raise the bar hommie :D
redboycaptures 1 day ago
Now every guy is going to have to do something like this.
xshonofthedeadx 1 day ago
The More Beautifull video for the moment
liltitan1000 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago
what was the music played when runs into the theatre with the popcorn in slow motion?
abeltherock 1 day ago
The black man in the background is best
FeelingLuckyPunk100 1 day ago
@mvaldezdz lol yes, yes i am being trolled lol
GDI109 1 day ago
@GDI109 no you're trolling.
mvaldezdz 1 day ago
@im123go Thank you very much ....have a nice day ; )
TheTheAnnashow 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago
Way to raise the bar....dick
shubadishwa212779 1 day ago 28
best thing I have ever seen.
ever.
GBassVlog 1 day ago
super cool dude!nxt tym Imma do this to my one and only girl! :) different move man, lol!imma not copy yours,., XD this is so perfect! :) nicely done,.,
alexisprinceM2 1 day ago
GO CANUCKS GO!!
MacManReviewer 1 day ago 4
Very nice i hope their marriage lasts for ever.
marthabirmaher 1 day ago
Presuming this is real....if he was going to go to this whole effort, he should have at least made the preview WAYYY better, pacing wise and such. Could have ended up much better with a little more thought.
clive2345 1 day ago
@clive2345 ARE YOU FUCKING KIDDING ME?!........
AlbertaSteeze 1 day ago
@AlbertaSteeze not in the slightest. The whole reveal was retarded, it had very little ummmppffffff to it.
But anyway, as stated by many. The whole video is most likely a total fake.
clive2345 20 hours ago
This has been flagged as spam show
MyPoem4u 1 day ago
gay!
mata168 1 day ago
this was pretty sweet
djkells3 1 day ago
Great job! That's true love.. Not many guys do what you did nowadays.. Congratulations!.. I'm still waiting for my bf's proposal.. haha..
xxelizabeth24xx 1 day ago
@xxelizabeth24xx Yeah, and not many girls are genuinely deserving of such treatment. You expect so much, but give so little in return. If you weren't so shallow and only went after a guy based on looks, then maybe you wouldn't be making such a ludicrous statement in the first place.
realmofsilence 20 hours ago
*le sigh*...what does it take to recieve a man like that who will put sooo much creativity in a marriage proposal....#lovedit
cebm07 1 day ago
everyone else in the theater is like "Yaay... Alright settle down... SHUT THE FUCK UP I WANT TO WATCH THE MOVIE"
thebsenior 1 day ago 7
Wow thats awesome! good job dude! (Y) =D
GeneralPanzershrek 1 day ago
the best!!!
keonmiss 1 day ago
stop talking in the theater bitch
SoccerDudeACW 1 day ago
That was epic!
xoxsupersxox 1 day ago
@wgamador
why would you resist? if you dont like it, why would you watch the ENTIRE video. this should make you want a girl. if you could get one.
rachelovesyoulots 1 day ago
@rachelovesyoulots
Yeah cause you know for sure that to the left of me is a woman laying down with nothing but her top.
Save it. You dont know me at all.
wgamador 1 day ago
COPYCAT!!!!!!!!!!!!!!!!!!!!!!!!! ALREADY BEEN DONE BACK IN 2009!!! Check out "My USC Movie Theater Engagement Proposal"
T0rche 1 day ago
this is amazing
cothman 1 day ago
Awwwh :) LOVE THIS !
Barbiiegirl123 1 day ago
what was the song called when he's running with the popcorn?
metalsnak6 1 day ago
@metalsnak6 it is called O Fortuna composed by Carl Orff
guidrynj 1 day ago
TUMBLR<33
SmileLee6 1 day ago
they probably fucked like savages that night
thomonkey22 1 day ago 4
Wow il s'en est donné du mal pour faire ça ! Félicitations !!!
juicyjuly22 1 day ago
This is a sweet marriage proposal, very well done, very similar to the one my husband did for me back in 2009 - check out "My USC Theater Engagement Proposal".
only1genevieve 1 day ago
@only1genevieve Just saw your husbands video. Looks like Matt stole his idea and got 12 million hits for it.
thaddeusvanderman 1 day ago
103,021 lonely women with their cats dream of a proposal like this
2,365 single men want to hurt Matt for screwing it up for the rest of us.
thaddeusvanderman 1 day ago 5
Comment removed
getsilly222 1 day ago
This is wonderful. There should be more love like this in the world. Well done ~ I hope your life is filled with much love and laughter. Just remember though, that the proposal or wedding is not what it is about, but the marriage that you spend your lives building. I think you are off to a fantastic start. Yahoo!!!
susanfryer932 1 day ago
the asshole stole my idea:p
HiroM2J 1 day ago 3
lol never expected him to add a Jagged Edge track to this vid.
dunkAmania002 1 day ago
This has been flagged as spam show
I2ogerlehot 1 day ago
what camera is this?
TECHLIFE20 1 day ago
@rosztun let me ask you this. do you think they give a shit that u didnt like this? do you think they are sitting behind their computer looking for pointers? did you make ANY difference by critiquing this video? keep ur dumbass opinion to urself. fuckin HATER. dont be mad that u have a small penis. and if ur a girl dont be mad that u would be lucky to have a proposal half as good as this one.
BV10707 1 day ago
@BV10707 You must be really really retarded, good luck living in your trailer.
rosztun 21 hours ago
longest trailer ever, now i want to see the divorce sequel
omegatestament 1 day ago 2
Fake or not.
Lame.
Marriage proposal like that are fucking corny. Agree or not, its the reality.
GuerreroBestEver 1 day ago
How hilarious would it have been if she said no.
GAYBLACKPEOPLE 1 day ago
you know this could be fake?
JustAnotherYtuber 1 day ago
@JustAnotherYtuber its not. we know the people. they live very close to us. this is the theatre i always go to. so no its not fake one bit
TECHLIFE20 1 day ago
de seguro lo vieron en taringa y por eso vinieron..............
FLYOATH 1 day ago
that was sweet, now if only all guys put that much effort into it.
ctakabahinah 1 day ago
@97Caylum really?
haniekunie 1 day ago
im not cyring....really
omgfgpaperclipx 1 day ago
AWESOME!
krazykap0 1 day ago
Profoundly stupid and clearly fake. The turn the lights OFF when they show the trailers and there is no way they got that clear of a shot without her knowing she was being taped. Oh and she just happens to not realize the theater is full of everyone she knows, WITH all the lights on?
mstenacious1 1 day ago
@mstenacious1 He did say i have another "surprise" for you and that was when her friends came down at the end and she was hugging them.. dont be jelous that was the best proposal anyone could have thought of
ilovecoke23 1 day ago
Comment removed
getsilly222 1 day ago
@ilovecoke23 I'm not the slightest bit jealous. I'd have said no and walked out if my husband did that to me. You're gullible if you think this is real. They just happen to have a website set up for the media to contact them? With a feed full of things like "Train just commented about us on Facebook!" or "Don't forget to follow us on Twitter!" This is fake, just like a bunch of other proposals gone viral in the past.
mstenacious1 1 day ago
@MaximusLupus THANk, this music score is so dramatic and good. =)
AkiraKeiKyo 1 day ago
@AkiraKeiKyo Most classical music relaxes the mind, this one prepares it.
MaximusLupus 1 day ago
2,362 men are making smart financial and life choices :)
getsilly222 1 day ago
whoooo..now time to make sum BABEZZZZZZZZ!!! =D
AdiTeachaG 1 day ago
i hate thumbs UP comments . thumbs DOWN if you agree!!
wighty44 1 day ago
That gave me chills lol, Beautiful just beautiful
music1jr 1 day ago 3
what a great proposal uncle matt
jnerize 1 day ago
2370 people were rejected XD
Rodmx90 1 day ago
Comment removed
Rodmx90 1 day ago
it would be funny if she said no
nickmaila 1 day ago 5
Beautiful Things:
beautiful couple,
beautiful proposal,
beautiful video,
inspiring video,
life is beautiful,
marriage
Subscribe to:
Posts (Atom)


